Description :
From Genome Similarity Track
Location :
Scaffold_2:1114129- 1115593
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000782Similar to Cys: Crustapain (Pandalus borealis)
Pytul_DAOMBR144PYU1_G000781Protein of unknown function

Sequence
1464 bases(100 bases per row)
TTCTGCTCGCGCAGCGCTGCGCGCTTCTTCGAGGAGAACCAGACGCCGATAGCCGTGAGTACGATTGTGACGACCGAGAGCACCACTGCGAGTGCAATCC
ATGTGCTTGGTGAGAGCCCCACAAACTTTTTCGCGCCGCCGCCATCGACAGTCGCCGTCGCGACGCCCGCCGTGGCGCCGAGCGGGATCACGGGGAAGAC
GTTGAGGCCGCAGTTCGCTTTGTTATCGGCGAGCAGCTTCATGTACCCTTTGTCGCCCCAGGAGCTGCCGTAAGAGTTCTTCAGAATCCAGTAATCACCT
GACGTCGCGTCTGTGCCGTATCCGACAAGCAAGAGCGCGTGGTTGATGTCATCCTTAGAGGAGAGATCACCGTCGTTTGGGCAGCTGTAGAAGCCGCCAG
AGTAGTCCTTGAACGGATCATCCGAGTTGAGCGCGACCGCGATCGGTTGGTCCTGCAGCGCATTGCGCAAGAGCACGTTCGGGTCGCTGCTCACCGAGCA
GTCCTTGCCAACAATCTGCGTCCAGTCGGTGATACTCGCAGCCGTCTTGTTCGACGTCGTCACGCACGTCTGGTTGGAACCGGACGAGCCCGAAGAGTCA
CTGTACGGCATCTCCAGCTCCGTCACGAGACCGTACTGCAATTGTGCTGCATCCATGAACGCGCCATGCGTCATGCCGCCGTCGCAGCCGTTGTTTGTGG
ATTTCCATTTGATCGAGTCGCTCAGCCACGTGACGCCACTCACACCGCTTGTCGCCCAGCAATATTCAAAGGTCTGTTCAGTTTCTCGAGTGCTGCACGA
CAGGAATTGCTGCGGCGAGAGTGCAACCGCAGTCGTTTGGTTGGCGGCGATGGCGACGGCCGTCTCGATGGCATCCGCCGCGGCAAACGCCCAGCAGCTG
CCACAATTCTGCTGACTCTTGACCGCCGAGCATACGCTGCGTCCCTTTGGGTTCTCTGTGTTGCACCAGTTGAATTCGCCCGTGCTCGTGCTGCTCGACG
AGCTGCTCATCGTTGCTGCCATCATCAGGCGACGACGCGTCGCTGCTGCTTTCGCCGCGCGCATTTCCTGGTGTACAAACATTTCCGGCAGCTTCGAGCG
CTTGCTCGAATCCGACAAGTGACGTTCGTGGACCCCCATCTTGTATGAGAACTCGTGACCCACACTGCGAGCGTACCTGTGAACATCTATTTATTTATCC
GCAGCACAACATGTCAGCGTGAGTCCACCTCTCGTCCCACTGAATGGACACACTTTCTTTAACCGCGGCTCACTTACTCTCTAGATACGTCATGTGTCGC
TCCAGGTTGCGCGCGGCAGTCTCTGTGTCCAGGCCACCTACCGAATTCGCTGCGAGCATTCGGCTGCGCAGCGCGTGCGCGTCGATCACCTGGCCATTCT
CGCCCGCCCACAAACACGGTGCGGCGCGGTCTGCCGGACAGCTCACGAGCGTCCCCATCGAGTG