Description :
From Genome Similarity Track
Location :
Scaffold_2529:1114- 2198
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2529-fgenesh-gene-0.0Cell division control protein

Sequence
1084 bases(100 bases per row)
ACGATCAGCGTCGCCGTTGAGGACCGAGGCGATTGTGGCCTGTTCCGCCTCTCTGCCGACAATAGGCAGCTTCCGCTGGGCCGTGCGCGAACCGCAGACG
CGCTGGAGAACGTACTCGGCCGAGTCACTCGTCGCTGGAGACATCGGCTCGCTGTCAAGGTTTTCAACACTCGAGTCTGAGAGCACTTCTTCGCTCCCGT
AGGATAGCGTGCGGCGGATGACTGGTCGCTTGAGCTCGTTAGATGGTAAGGATGCTGTCGTTTGCGGTTCGTCTGCGTCGGCGGCTGCGCGGCGGTCGCT
CTCGGCCTTTACCTTCTTCGAGTTGGGGGAGATGTAGTCCAGGATCGACTTTTTCTCGGCCGCGGTGCTGTATTTGTTTAGCGCTTGCGTGGCCAGCGCG
ATGACTTCGTTCTCCTTCATCGGCGCGGCACTCGTGTCAATTGTCAGCGACGGCTTCTTCATCGGCGTCTTGAACGCGGTCGTCACCAACTTGTTGTTCT
GTTGCTGGTGGTGTGTAGTTGCGTGCTGAATGGCCGCATCGCCGAGCTTGGCCTTCTTGGCGTTGGACGACACGAAGTTGAGAATGGACCTGCGCTCGAC
GACGGCAGAGGAACAAATGGCGAGCTTGCGCTTCCGCGGCTGCGGGACCTTGCGCACAGGCTCGGGTTGAGTGGCGGCTGCTGTGGTCTGCTGCTGCTCT
GCGAGCTGCTTGGCCTGTGCCCAGATGCTGAGCTGCGAGCGCGTTCTCATTCTCACGCTCTCTCCTGCTGTGCGTGTCTGCTGGCCGATTGCGTTGTGAG
GGAACTGAATGGCGCCAAACGTGAAAAGAACCCGCCAAAAAACAAACTGAGTCCGGGCTGAGTCCAAAGTTTTTTTCCCACTAAGTCCGAATACGAGCTG
ATAATACTCAGATTCGTAGCAAATCCTATTTTCTAATTGGCTCCGACAGCATTTTCAAACAATTTGATTTCAGTAAAAAAATTCATATGTTCGGACTTAG
TCGGGGACCACTAACTCCGAATATGTAAAAAAAAGTATACTGAAATCAAGTTGTTTGAAAAGGCTGTCGATCGGATTTACTATC