Description :
From Genome Similarity Track
Location :
Scaffold_947:1114- 2146
Transcript NameFunction/comments
g6634.t1hypothetical protein

Sequence
1032 bases(100 bases per row)
TTCCGGACTGTGGCCACTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTT
CCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATTAAGATTCCACGCGACATGCTCATCGACAACCC
CGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCG
GAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTG
GGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGTAT
CCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACGCGTCTGCGAATC
GTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGACAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCG
ACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTA
CCTGGGACTGTACTTGGCGACTCCTTGCTTTCCCCACGGTCAGTTGTATGTGGCCATGTCAAGGGTTACGTCGAGGTCGAGATTCAAGGCGTTGGTCGAG
TATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGTGACTTCGTGTGAATGCATAT
TTTACGAAAGAAATACATTTGTCACTTTGCAT