Description :
From Genome Similarity Track
Location :
contig_187:11139- 12143
Transcript NameFunction/comments
g11985.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
CCTGCCATGCATGCGTACGAGCGCGCCGTGAAGGAGTTCAAGCGAACCAAGATAGGGAAGGAACTGGAAGGACGGATCGTGCTGTTTGAAGCGCTGGCAT
CGAAGTTGGATGAAATAGCAGTCGAGCACGGTGTCAATCTCGGCATCTCCTGGAGCAAGCACTCGTGGTCGATGCAGCCAGACCTATCGTACCCAGACGT
GTCGACTCATGCGTTCCGCTATGTGAAATCGCAGCGCAAAGGCATAAGGGGCTGCTCAAGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGC
AACCCGAAATTGACACGTTCGTACGGGATTTCAAGACCCGTGCCGCTCGTCTGAGCGACAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGA
GAAGGATGCTTTGGAAGACCATGGACTTGAAACGACTGCTGAAGACGAAGATATTGCTAGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTC
AGTTCAACATCGCGGAAGCGCAAACAAGCACATAAGGTAGCAGAGCTACCCGACACCTTCGGTGTCTATCCCCAGCACATCGTTCAAAGCGCACGAAGGC
TCCCGCGACGACAACACCTCCCGCAACGACACACCTCCCGCGACGACACCTCCCGCAACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACAC
CTCCCGCGATGACACCTCCCGCGACGGTCGAAAGCCTACAGTTCCACTTTCCGTGGCCGATGCACTGGCGAAGATCAAAAAAGAATTCCCCAGTACGTTA
AGATGACTGCGGAGGAGTTGGTGAATTTTCAGAATCTGCTGGTTAATGGACAGCGTGCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGT
CACGAACAGAAAGAAGGGCAAGTTCGTCAACGTTACGAAGGACGTCTTCATGCGCATGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATC
GCGG