Description :
From Genome Similarity Track
Location :
Scaffold_33:111344- 122000
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13469hypothetical protein
Phypa_INRA-310PPTG_13470flap endonuclease 1
Phypa_INRA-310PPTG_13471hypothetical protein
Phypa_INRA-310PPTG_13472hypothetical protein
Phypa_INRA-310PPTG_13473hypothetical protein

Sequence
10656 bases(100 bases per row)
CGCTTCTTATGCAGCTCGCTCGGGCTGGAATCCCGCGTCACTTGCGAGAACGTGCGTATTTTAATCTTTCTGGAGCGAGTGAGAAGCAGGCTAATGCAGG
ACCGAACTATTACGCAGAGTTGGTGAAGAAAGCCGAGACGATGGAAACGGAGACGTTCCGCCAAATTGAGCTGGATATTGACCGCACGTTTGGACACTCG
GGAACGACGATATGTTCCGTGTCAGGACGTGATCAGCTGCGACGCATACTTCGAGCCTACTCTCTCCGCAACCCGTCCGTTGGTTATTGCCAAGGACTGA
ACTTTATTGTGGCGTTTCTGATGCTGATGGCGGATGAAGAAGTTATTTTCTGGCTTTTGAGCGTCTTCTGCGAAGATTTATACCCTGGCTATTATTCTCC
AGCGATGAGTGATATCCAGAGAGATATGTTGGTGCTGAAGCAGTTGATCGCTGAGGAACTTCCTCAACTGGATGAGTTCGCGGCGGAGGTTGGCCTACCG
TTAGAGCTGCTGGGCTCGCAGTGGTTACTATGTTTGTTCACGATGACGTTCCCGAGCGAGACAGTATTCCGTATTTTTGACTGCATCTTTACGGAGGGCT
CAGCTTTCGTGTTCCCTGTCATTATGGCGCATTTGAGGCGGATGGAACCGATATTACTGGATCTTGTGGAGTTCCACGACGTGCTGTCTTCAATCAAAGA
CGCGGAGAGTGCTTGCATCGATAGCGATCTGTTTATGACAGCAGTATGCAAAGAAGCCGAAAGTATCACGGCCTCTCGAGTTCAGAAGCTTCGGGAACAG
CAATGTGGATCTGTACGCAGCGAAATGGAGCGAGCTGAACGTGCTCGTGCGTTTAACCAGCAACTTGCTGTCGTCTACCAGATTCCTGCATTCTCTACTT
ATGCTGCGGGGCTGCTTCGCTTTTTCCATGAGGAAGCAGAAGGATCCTCACGCTCGGATGTGGCCTTCGTATTGACGATGCTCTGCCATGGACTCGTGTG
GCTTGCAGAGCACTCTAAGCGATGGAGCTAAGAAACGGGAAGAAGACGCCCAGAATCGAGGCGCTTCAATGTTGCCTCTATTGTATAAGCCGTGCCGATA
AGTATTTAATTTCTGACATAGTTGTAGGAAGCGGGACTGTCGTGATGTAGTGAACCAGTCCCAGACAGTAATGTATAAGGCAAGGATTTGTAGCTAGTTT
GATGAGAAAATGTCCACTGAAGTTGGCTCAAATAGTATGGTTCCTTATTTCTTGCCCTTCTTCGCAGCAGCACCCTTCTTACCGCCCTTGGCAGCTACAG
GTGCCTTACGCTTCTTAGCGCCACCAGCGCTCGGCAGAACCGTGAAGAAGCTGTCGAGTCGCTTCTGTGACTGGGTGCTCTTAGACTTTTTCAATCGCGT
GATGGCTGAAAGCACTCGGTCCTCCTGGAATCCGTGCTTTTTGACCAGGAAGTCCAGCAGTTCGGTCTCCTGTGGGTCGCGCCACTTGATCTCCGTCTCC
TTGGCATCCACAACTTCGGGCTGAATGAACATATCGCGTGCGTTCTTGTAGATGGGATTTTCTCCCAGCCACTCGTCCGGAATAACCACACCCTTGCTCT
TGTTCTTCTGCAGAGCCTCAAGGAAGTTCTCGATGTTCTTGTGCTCCTTGATACCAGCGAACGCCTTCTTGGGACCCACACCGCGAATTGAGTCACAGTA
GTCGCATCCACACAAAATGCACAGGTCCACGAACTGCTCCTGCGTCAGCTCAAGCTCCTGCAGCGCACGCTCCAGGCGGATCTCCAGGATCGGGATCTTC
TTAGCCGGTGACACTGTCAGACGACGGTACAGCACGGGCACACCGAATGTCAGAGCGTCCATATCCTCCGTGCCGGCAGCATAAACGCGTCCGCCCTTGG
CAAGCGCAGCACACGAAGCTTCAGCCTCGCAAGGGGCCGTGATGTGCGGTACACCCATGAGTCTTAGCAGTTCCTTGCAATCTTCGTTATGCTGCGGTGT
GGCACGCACCAGACGCTTATTGAAGCGGTCAATATCCTCGGCGTTGCCCTTCTCCGTAGCCTCCTCAAGCGCCTTCTGTGCCTCCTGGCGACGGTCACTA
CGCTTTGCTAGTTCGCCGCTCTTCATGACTGGTGGCTTGCCGTCGAACACGTACACGGGTTTAAGACCGTTCTCCATCATACGGATAGTGCGGCTGAACA
TGCCCTGCAAGTGGGACGTCACCTCGCCGTCTGCATTCGTCAATGCCTGGGAGGGACCTCCACCATCGGCAGAGCGAATGGCGATGAGAAATTGGTACAA
CGCCATACTAGCATCGATGGCCACAGCGTGTCCCGCCAGCGCCGACATCTTCTCCACCTCCTTGATGCAGGACGGAGCCTCCTCCTGCAGCAGCTTCATC
AGACCTTTAATTCCCATGCTTGGCGCGCTATCTGGAGCTGTTGGTTGTGGTCTAAAATGGGTTAAAATCAACTTGCAGCGGGTTGAAACAAAATATTTTT
CCCGCCAAAATCTCTAACATAACGGGTATAATTTCGGTTAAGAATATTTGTAACTTTTGTGAAATTGCCTTTCATTTGTCTCTTCATGGAACATAACGAC
TACATCGACAGCAAGATCGTGCGCTATGAGTACGGGGACGTGCTGGACGCTAGGTAGTGGTGCAAAAGATAATCATGTAAGCCTGCGCCTCGGCGGTAGA
CGCGGATCTCTAGGACGCCTATTTCACTTTCGTGACTTTGGAGTCACCACCGGTAAAGAACGAGACGTCATTTCCTCGGTGAAATGGTAACCGCGACTTC
TCTATTTCTCTTGTGCCAATGACGAGAGTCTATAGCCTGCTGCATCTCAATAGTTTCGTTTAACATGACTTGCAGGCACAAACGCGACCGCTGAACAGAC
TCGTTCACCACCATACACATCAGGCTCCGATGCTAACAAACCGACTGAAAGCACAGCAGTGGAGCTTTGAGGTTTCCCACGAATTGACTGGACATGGCCA
CATCCAAATGGCGTGACGACAGGATCGCCGATGAAGAAACCACAACGTAGTAACTTGAGACGCAGCTCCTCTTTGTTAGATGAAGTTTCCAGCACTAAAT
CCTCGACACGAACTTTGCCGTATCCAAACGAAAACCGAACTTCACAGAAGCCCACATCGTAGCAAGTCTCGCGGATAATCCCAACACCCCATCGACGACA
ACGCACCAAACTACCAACAGACAAAATGGAGGAAGGCTCCAGATATGCTTCTCGACTCCAGGGAAATTTGACCTCAATGCGCTTGTCAGTAACTCGGAGT
GCCGTGATTACCCCGGAGCCGAACTTAGTCGCAACGATGCTCCCCACGTCTGTAACAACAACACTTACACGTTAAAAGACATTGCCACTAAACCTACAAA
GCTCAACACGCTCACTTACAAGCGTGTGGAAGAAGTGAGCTGGCATCGCCAACGAAACTGAGCCCCTTTCGGAAAAGCAGCGTCTTGGCGACTTTGACAT
CAAGAAGGAACCTGTTCAGCAGCCCGAATACGTACTCGGTCGACGATCCATTTGAGTCTTCCGCCAAATACCGAGCTGTGCCGTCCCACACGGAATGTAA
TGTCTCCAGATCCATCTCAATGTCTTCAAATGCGGCTTTGATGTTCATCAGTCGCTCTCTCATGACTGAGATGAATTTGCTCTTCATCTTGTACTGACGT
GGTTCAAATTTCTCGTTCGCTTTGCTGGAGCTAGCCCCACCAATGTCTGACATTTCTTGTTTTGGTTTCGTTGCCTGCTGCCTGATCGCTGCTAACAGTG
CAGCTTGTGAGTCACCGCTTAAAGTGGATATACCATTTTGATCTGCCCCGGCATCGCTGTTACCTGCCACACGTGAACGGCGTTGCTTGATGGATGAGCG
ATGATTGCTATCTGGATTAAACGTTGGTTGTTCACACTTTCTGATAGAAGCTAGGAGCGACGATCTCGCGCTTGATGCTCGCACTGCCTCACTCAAGCGC
ACTGAATTATCTTCGTTCCAGTTTGTTTCATCTCGTACGTTTTGTGGACGACTACGAATGGCATTCAATAGTGATGCATGAGGTGAACTTGCGGACGAAA
TTATAGCATCCCGATCCACCTCAAAGCTAGCATGTCCCCTTTCACCCGCGCTTATTCTGGCTGATAAGTTTTCCTCAGTTGACTTCGTATCAATTGCTCC
TCCACGACTACGGATTGCAGATAGCATAGCAGCATGCGGATTATTCGACGTGAGTCCATTATTCACGGTTTGAACCCCAAAATCGACCACCGTGTTTGAG
CCTCGCTGTCGAATTGCGCCGAGGATGACATTTTGAGGATCTGACTTTCCTTCTTGCGGAATATTGGGCACTCTGTTACTCTGAATTACCACTGGGCGAT
GCCGCTGAACCTTTCGCTCTTCAAATTGGTGCTTTCTAAGCGCCTCAGCTTTGTTGAATCGCTTCAAATCCTCCACCATGTCTTCCTTAATCTCTTGCTC
GAGCTTGGTGATTTCCTGCTGCAATGATCGTGCTTGAGAGTCGCAGATCACGTTAGAGTATCTCCTCGCGTCGATCAATGTACTAAGGTCGTTAGTAAAT
AGTAAAACATCACCTTCACCGCGGTTCTAACACACGACAAAATCACACATACTTAGTTCAACGAATCAGTAAGAAGCCAACAGCGGGACACTTACGTGGA
TAAGTTTGATGATGAACTGGAGGAGGGTCATACTTTGGTCTATAGCCTTGGTCTCTGACAGCTAAGGGTAGCAATATGAGCATTCAATTAACATACGCTG
GAACGATCAAAGGCAAGGCTAGACAAACGTACCTTCAAAAGAGAAGCAAGCGTAATACCGTGAGCACCTTCAAGTTCTGTGCCGGTGTTCAGAAGATTTC
CAATCACCAATACCAATTCGAAGCACCGGGCAAGGCGCTCGCTCTGCAGGATTTCGTAACAGGCCTGGGTAATCACCCGAATCCGGTTGCGCAACTCTTG
CTGCTGGTGTTGAAATTGTGAAGCAAAGAACATCACATTAATCTGCATTCAAAACAGCAAGCATGTCAGTCAACAAGCTCAAATTCATAGACCAGCGTCG
TACTTTTTCCGTCACTCGAGGAATCTCACACATTTCCACCAGGAACTTTTCTGCAGGTTCCAGTCGTGAACGAGATCCTCTGAAGTTGGTGTAACGCTTC
ACTTCAACACTGTTCGGCGCGATGTCTTGCAGATTCGTCAAGCGGTCGAGTGTGAGGAATTCAAAATCACAGTTCTTTAATGCTGACAAAATGGCCGCCG
CCCCTCCAACGGCCTTGAATTGGCTCAATCCAATTGAAATGTTGTTGGATCTTCGTGAATCAAGAGCCGAGAATCTGGTCTTTTTTGCACTGGTTACCTT
GGACTGGGAAGGTGACGCTGCCGTTCGGTTTCCGAATAGATATTCCAGTTCTTGAAAATCCTGTGGCGATAGTGTGATCGGAGCAGTCTTTCGCCTTGAG
GTCACACGAGACCAGATAGTTTCGTTGGCCTTGTCCGAGTCCAAATTAGTCCAGTAAACCTTACGAAAGGTGCTGTCACGTCGATTTAAACCACGACTAC
CCGATCGTTCTCTTTTACTATGGACACAACACAAAACAATATCAGTACAGTGCATACTTACTCTATCGCTGAATACCTACACACCTTGTTGTACGACCAA
AACCGGAAGCAGTGCTTCCCTCAGGACCTGCAACAAATATTGCAATTTTATCCGAAGTCATTTCGTCTTGAGTCATTTTTTGGGCCACTCCGCTGGATGG
AACACCAAAGCTAAGCATCTTGAAATACTTGTCCATAGCAGGGTCTCTGCGAAGCGCAGCGTACTCTGGTCGTTCACCACTTTCACCAGCACTTTTGCCC
TTCATATTAGCAATACGTGCTCGCTAAAACCATAAATGTTAGACGCATACTGCACACTTCAACAGTAATCGACTCAAGGTACTCACCTCTTTCTCTTTTT
CTTTGATGAAACATCCATCGCAGACTTTCAACTGTTGACCCTTTCCGTTGACTTGAACATGATGACGAGAGCACTGGATACACACGATTTTCTTGCAACA
AGGGCATTCGTGCTGTCGGCTAAAGAATGAGAACGGGGTCAGACACTGGTCGCAGGCTTCAGGATTTCCTTCACTTGATAGTAAACCTCCGATATATGAC
ACAGGATTAGAGAGAAGCGAGGAGCGGAACCCCATAATACCATCATCCATGTCTTGATTGCTTTCTCCTCTCACTTGTTTTCGTTGAAGTATCACTTCCG
TCTCCTCTTTTTGATGCAATGACGCCATGTATTCGGCACAGCGTTCACTTCCGGCCCGCGAAGCGTGATTCCACGAAATAGATTGAGCCATTTCCAAACA
CCCTTCCCATGCCGCTACGTACGCGGCTGTATCAGCGGACAAGTATCGAATCTGAACTTGTTTTGATCGAACCATAGAGTACGAGTTGTCCAGTTTCAGT
GTCAGACCTCCAATTGGACTGGACTTAAATCGCACGATGAGTTCAATCCACTCGTCCAAAGCTGATAAACGTATTGGTTTAGTCAGATCTTGACCATCTT
GAGTAGCGACGGAGAGCAAAATATCTTGCGTTTGGACGCGTAGCTGCGCTAAGACAACGGGGGCGCCCGAAACCTCAGAGATTGAGAGCAGCTCAAATGT
AGAGCGTCTGCATTACAGTGAAAAAAAGATGGTACAGATTGGTAACAATTGTGTAGTTAGATTAAGGAGTATCGAATACGTACCCAATCACAGTTTCTTG
AAATGGTTCACCGTGAAGAATGTACCGAGGAACGGTGCAATTGTCAAGTTGCTTCATTTCGTCAGGATCTCCTTCAATGAACTTCATCACACTGCTTTCA
CTTTGCACGTCATCATAAAAAGCTAGTTCGTTGCCAAGAAGTGGGGCTTCTGGGGCGCATTGCTTGAGATTGCGTGGAAACTGGGATTGGTCTTCGTCGC
TACACTCGTCAGGAGGATAAGCAGCTAGCAAAAAAGTGACTCCATTCAACGCACTGAGAAATGAAGCGATTTTTCGGGCGTCCTCATACTTGTACAAAAG
GGCTTTTGGCTCATAGAACTTCTCCACAACCACTCTCCGTTTGCTCAAATTCTATCATATCGAAACATTAGAAAAAGTGTGACAAATTGATGACCCACAT
CCATATCCACAAAACGTACTTCGAATGCACGCTGTAGAATTCCCTTGTTTAAAGTCAGCAGTAAAAAGGAGCGAGAATTGTTCCATCCCAGATACTGCAA
GTTCGACGGAGGTTCTCCTGCTTGTACTTCGGCGACGATGCCCATGTCGTCGCGCAGCACGTGTTGCGTCTTCAGTAAAAATTCGTAGAAAGGTGCCTCT
GGCCACACATCCAGAAATTCTTCCTACGTTTTAACACATTAATGAGCCACTCATCATACATGCATACACGAAAAAAAATAGTGGGCATACCTTGATTCCA
TTGCACAGAACAGCTTCGAGCGCCAATATGAATGGCCGAACGGCTCCTTCATGCAGTGGACTGTCAGGTTTCGCAATGAAAATCGACACAATGTCCATCA
CCGCCTGCTCCAAATTCGCTGTCATTCTTTCGTTTCCCACTTTTCTTTCTTCGTCACTCATTGCACGCTCCTTTTCCAATGTCTTTGCTAAATGAGGAAG
TGGCAATCCAGCTGCCGCTCTTCTCGCTCTTCTCTGCGAACGCGACTGCGACTCTTGCACTGCCAACTCCGCAGCTGCAACGACACGGTTTGATGTCATT
AGGAACCGATACCGCACCTGCTTATGGCGCACTAACGAGTAGGAATTGTCCCAACGCAAAGTGTACACGCTTTCTGGTTTGATATTGTCGAATCTGCCCT
CCATCGTCGACTCCATAGGCTCAACTTGCAGCGGATGTGGCACCATCATTGCGTTTGTATTTGGGTCACTGTCATCTTGCTTCGCCGCGTTAAACCGCCC
TAAATCCTGCACAACTACCCCATTTTCCAGCACTTGAAAACCAACATCGTACTCGTGGAGCTGGAATTGCCACAACAAACACTCCTGCGGATCGTCATTC
TTCTGCAATGCAATAGAAGGAATGGGTAGAGCTATGTCTGCTACGCTTCCCCGTCGAATATCCAACGAGACCCATGGAGCCGCTTGCAGAAGGAACGAGG
CAGCAGTCGGAGGCATTTGACACTGTCCTCCCTTTCTCCACTTTTGACTCGAAAGAAATTGAATTTGAAAAGCGACTTGTGAGACAATATGAATTTCAAC
CAATGAAGAGGCAAATTCAATTTGTTTAAGCCAATAAAGTGTGGTCTATGTTATCAGTTATCAGATGGCAGTCACAAAGACTGATAACCACGACGGTTCA
TGTAGCGCTGGAACGTTGTGGCCCCGACTGCACCAAGGGCAACTAGACCACCGGCCGTCAAAATTGACCACAGAACACTCGTACGTTTGGGCTGTGCCTC
TTCCTTCACTTCGACGATCGTCGCGTCATTCACCACCACGTTCATGGGCTTGGGAGTCTTGACGGTCTTGACCGCAGGAACGTTCACTGGATGGTAGTCG
CAGAGATCCTGCCATGGACCGGTGGACTGGATATGGTTCTCGATAATAGCAGTAAACTCATTCAAAGGGCACTGGAGTTCGCAGGTGTCGAGCTTGACCG
CCGTGCGAGGGCTGAAGGGAGACCATACGAACAGTTGCACGAAGTGGTCGTCACTCTTGCGGTACAGTTCGAAGAACAGCGTCGACGCCGGGTGCAGAGG
CGTTGAACCATTGTACTGTGGCAGACCCTCAAAGTTGAACTTCATGCCCATCATGAAGCCCAAACCGTGCATGAGCTCACGATGGCCGTGGTAAGATAGG
TATTTGGGACTCTCCGGGTTCCGATTTGGTGAAGCGCCCTCACGCAAATTTCGCACTAGAAGTTGTGGGAATCCTCCGATGGCCACAGTGATTTGAGTGG
GCGTCGAGTAGAGACGTTCAAGAAGATGCTGGAACGCGAGCTCCGAGACATCCCTTAACAACTCGGGTGTGAGTCCGGGAGCGGGGTCATGACCCTCGTC
CTGGTCAAATAGGAACATGTCGTTCACATCCTTGATCGCCGTAACCGGATCATTACCAGTGTAAAAGACCTTTCCGCAAATGTCAGCAAGAGCTTCAAGT
GTCTTCTTGTGCTTCTCGATTGCAACCGCGGCTCCTCCTTTTAGGTACGCTTTGTTATTCGCCGACATGACCGGCCAGCAAGGTCCGTTCGCGGTGAAGT
CGTGCTCATTCTCGAATAGCTGCATGTACACAGGGATCGGTTGTCGTGCGTATCCGTCGGGACCAGTACCCTCGGGATACAGTCCATAGCCCATTGAGAT
TGCACTCTGGCCGCATCGATTTGCAGCGTCGGCTCGGAAGTATCCCTCGAAGTGCGGATCGTCTTCCGGTCCATTGAACGTCGGGGACAGGAAACCTTTC
TCGTTCACATACACTTCGCGGATATGATCTCCCACCTTCTCCATCTGCTCCATTCCTCGCTCAGTGAGCTGCTCGAGCGGCACCGAATACGCCTTGACAT
TTGGCAAATTGTTCGGACAGTGAGCCTTGACCGTCGGATTCGGTGCACGACTACCATGACGCGAGAGTGAAATGAGCATCACAAGCTCAGAGTCCGTCGA
GGTATCTGCGCTGACAGCACTCAGCATCAGCGAGGCAAGCGCAGCGAGGATGGCAGGGATCCGCATCTTGGAAACTTTTTTTTCACAGTGTCGTCTCGCT
TGGTGGTGGTCTTGCAAATTCCGAAATGAGCTTGTATAAGGCAACGCTGAAGCACCGAGCTAAGGAAAAAGAACCCTTGAAACCCCCCGACGCCACTTTC
TAGTTGCAACGGACGCATTTGATCAAAACGGCAACTGTCTGAGATGGCTACAATTTGTTGTGACCTTTCGTCTTGATTGATTTTCACCAATCAGATGTGA
CGAAACACAACAGATTGGACACCAGCAGCTCATGTGTCAATTGGCATGGAGGCGACCGCTGTGTACCCCAATGCTGTGCCAGTGCTAGCCTCCAATGGAC
TCGGCGTGACGTTAGCAGGCACGGACCCGGACCATGTGCCGCTCGAGCCCGACCTGATCAATGATGCGCGTCGTCGATTCTTCCCAGACGGCTGCGCGGT
GGATGCGATCGGCGTGATGCGTCTGCATGTTCGCAACGCACTGGGTTACGCGTTCCTGCGACCACATCAGCGTAAAAAGCTGCTACCCAAACATGGAGGT
TTAAAGGTTATGAAGGGGATGGATTGGTATTCACAAGCGGCATTCTACCGAACCAACTACCGCCATTTTGTGCCGCACGATCTGATGATGGACTTCCTGG
AGAACGAATGCCCGTACGTTGAGATAGACACTGCTGCTGCGTTGGAAACTTGTCGTTGACTTGAACAATTGTATTCCGTAGCCCACAAGTAGACTGCTAC
AATTTGTCCAAGTGGCAGGGCAATGCGATTACTGGAGTCGACTGTGGCCAGGACGGTCATGTGATATTTTATCCTACAGGGCATGTGTTACAGCAAGCGT
GTGCATGGTACAGCAAAGGAGAAACAAAGGATGACCCGCCATGCTCAAGCACTGTG