Description :
From Genome Similarity Track
Location :
Scaffold_424:11134- 14362
Transcript NameFunction/comments
Phymu_g9767proline synthetase co-transcribed bacterial protein
Phymu_g9768hypothetical protein
Phymu_g9769hypothetical protein

Sequence
3228 bases(100 bases per row)
CGTCCTGTGAACCTGAAGCGGACTCGAAGAGCCAATTTTCCACAGAAGAATCCGACAAATCTGAAGAATCCGAGGAATCTGAACCCGAGACCAAAGCGCT
CTCTTCACTATCCGCCGATGTGCTCTCGGAATCGAACGCTGAATCCTCGAAGGACCCGGATTGCGAGTCAACCCAGTTACCAAGCGAACTAGTTAGAGAG
TCATCAAGTAATGAGTTGGATGCGCTGTAGCTCGATCCGCTGCCCCATTCTTTCCCTTCAGAAATTGACGAGCCAGCACTCGAACCGCTTGAACTGTCAT
TCGTTTCATCACTGGTCGTTGGTCCATCGTCGGAGCCATCAAGCCACGACGACTCCCTCCCCACGCTACCAGTCCCAACATTGCTTGACCCGCCAATGAT
CGACACTCCTCCCCCTGTGCTATCCGCGCTGGTGGTCTCCGCAGTGGTAGTGTCGCTTGTGCTTTTTAGAGTCGCAATGGCAATGACTCCGAAGACCGCA
CCACATACCATGAGGAGCGCGATCGCTCCACGTGTGCTCCACGGACGTGTCATCGGGACTGGAACTGACCGTAAAACTGGATACCGCGTCAGCGCTCCAC
CTTCCATTTCCTCGAGGCGATCGAAGCCACTCGAGTGGTACAGCAGGTTGTTGCTTTCTGTCATCATTTTTGCTTTGCAGACGTCGCTTGTTTAAGCTGA
CAAAAGATTATGCGTGTGAGGGACAGCAGTCGATTGGAAAACTGGACCAACGTCTCCAAATCCGCCAAGGTCAAGTCCGTTGAGCTGCGATCGCTCCGTC
AATATTTCTCTTCACGGCATCCCACACAACCTAAAATAGGCAAAGGACATCActttcagcagcatcgccagctcTACACAACTGACCATCATTATACATA
TACATTTCCCAACTCTACATCAAGGAAGAAACTACCATGAGATCGTTCAACTTGTCTATGATGTGAACCACCTCACATAACTTACAATGCGTACACAAAT
TATGTGTACCTAGCCTGAATCGGTGACGTATTTCTCGACCACTACTCTGCGCAATGCTGCGCCAATTCCTAGCTGCACGCGGCGGCTTGGGGCGTCGCTC
GCAGGCCGCCCTAGGCGGTAAATCAAGTGTTATCAGATGCGCTGGGACATCTTCTACGACATCACCGCGCGCTCATGCCCAAATCAATATGTATAACGCA
CGTCAATGGATCGAAAAAATCGCTCCGAGTCTGCAGACTTTTTTGGCTTTAGAGAAGCACCTGCTCGTCCCAAACAAGTTCATAGTACCGTATGGAGACA
CAGCATGGCCGGAGAAGACCTGGGGTTACCCGTTGGGTTTGTACTGCAAGAACCTGCGCTCGCTCCGTCACCAAGGCAAGAATCTCCCGTTCTTCGCCAT
AGAAGACCTGGAAGCCATCAACTTCCCGTGGGATATGCGGCAACACAAATTCGACGTCCTCGTGCTGCCTGGGCTCAAGACATATTTCCAGATCAACGAG
CACTGCGACATGCCCACCTCGTTCGTGGTTCCTGTGGGGGATGAAGCCTGGCCGAAGGTACTGTGGGGTTTTAAACTCGGACAGACTGTCATGGGAATGA
GGTATGGCGACTCGTACAGAGTCCAACGGGAGCGCGCTGCtgacgagctggagaagattggCTATACCACGCAGTCCTGGAAGGCCCGTCAGTGGGAGAC
GAAGATCTTACCCGCCTTAGAGACTTTTGAGCGCGAGTTCAAGCACTGCAACGTGAATTTCAACTTTGTCGTGCCGAGGAACAACAAGTGGCCAAAGGCG
GCAAGGGGAATTAGACTGGGAGCGATCGTCGCCAATATGCGTTGCAGAAAGAACTACGTTGACTTGGCAGAGCGAGACAAGGACAAGTTGGAGGCACTTG
GCTTCATTTGGTCCCCGGACGAGCACAAATGGACCGACGTGATCATGCCGGCTCTCGAGACGTATAACGCGCTATACGGGACAGGATGGATTCCGGTTGG
TTTCGTTGTCCCGGATGAAGCGCCTTGGCCAGAATCAACTCGCGGACTTCGACTTGGAAACATTTTCATGAAAATCCGGCACACAGGCGCATACTCCACA
TTTGTGGAGAGGGATAGAGAGCATCTGGATGCAATCGGCTTCGACTTTAACGTGGACTTTTTCGCGACTGTTGCAATGAATGCCAACAAGTATTGATCAG
TGCACAGGTAGAGATATCGTTTTTGCGGTTTTTACTGTAAAGTTTAACTACTCCCACAGCATGTTTTACCGTAAAACACGGATTCTTTTGAGAATTCATC
TTTAAAATATTGTTCTTGTATTTTAAATTATGTTTAAATAATTTACAAGAACAAGAATAATTATAAGCACGACGTTTGTAAAATGGACGACCTAGACTTC
CCCACAAAGAACTACGATTACATCAAGTTGATCAATTTAATAAGAATCGGCTCTGCGCCATACTAGCTACTACCTACGTTCACGCGTTCACTGCTGTAAA
AGAAAAATACTACTCACGACGATTTAGTCGTCAATGTCATAATACTGGTTGGACATCGATGTCGGCGTGGAATTCGAGCGTTCAGCTGCCTGCCACTCGG
CCAGACGCTTTTCTCGCATCTCCTGCGCATTGAAGCTCAGATTCGACTGCGCTCTGTTCATGCTTATCTTGGCGTACTCGCTCTGCAGCGAACGCAacag
cgcttcttgctggccgATTGAGTGCTCCATCTCGTGGAAACCAGTGTTAGcctgcagtgctgctgtagctgccgctgccgctTCAGCTGACGAGtacgtg
gaggagctgcccATTGACAGTGAACTGTACATCGATGAAGCCGAGTTGTGTGCcgacgagacggaggaggaactcACCGAGTTGTTGCCATTCAGCGTTG
GCTGGCTGCTCCTCCTAATTGGAGGACGAGCTTTACGCGTCGCTTGCTCGTAGTGGTGCatctgatgctgctgctccacaaAGCGGTGCACTGGGGTCTG
TTGATGTCCGCCGAGGTATTTGCGCTTCTCATTTTCCAGGTACCGCTGCTTCAGGCTCTGCAAGCGCTGCGCTTCCGAAATGGCAGCGTGCATAGCTCCA
GGGCCGTCGCCAAGCATCGCGAATTCCACGACAgacacgtcgtcgtcgtcagcctcgtcgtcgtcgtcaacggTTGGTACTGTGGTGGATGCGACCACCG
TTCCGCCAAGTAGGAAGTCGTCCATGCG