Description :
From Genome Similarity Track
Location :
Scaffold_1054:11132- 13025
Transcript NameFunction/comments
Phyta_totarag11876hypothetical protein

Sequence
1893 bases(100 bases per row)
AGCAAAGTTCATATCTAGTGTGGTTGTACCCGGCGTGCTTTCAATGTGAAAAAGGTCGCAGAGAGTCCTCGAGCTCACTCCTTGGAAGTTGCTGTCATTC
CGCGTCAACTGAGGTCGCATGGGTAGGAACGGCACGTCGGTGATGTGAGCGGGTACTGCGTTCTCGTCAACACTGTCCTTACTTAAAACTGCTGGAGTAA
GCAACGTCGAGGTCACGAGTAGAGGGAGTGGTGGCAGATAAGAGTTATCTGTAGTGATAACCAAGTCTTCCTCTCCCTCGCTCAGTACGCTTTGCAGGAG
CAGCGGGTGATGATGGATAAGCACCGTTTGATGAGTGCCTATGTTGTCACTTAATACCTCACTCTGTGCTATGGCAACTAGCTTGAGCAACTGGGCATAC
TCGATTtgcatctccttcagctcgaACAGTAGTCTGGCAACACTGTTGAATCGATAACTTGACAGATGCAAGCCAAAGACTCGTAGCGCCACTCGCATTT
TCTCAACATCGATAGTTCCAGACCGATTGGGATCATGCACCTCAAATTGCGCCTGTAGATCACCAACAGACAGCTTCTTTGCTTGCATGCTCCCCCAAAG
CAAGACAGCGAACTCAGAGCGTAGCTCTACGATTTCTCGGAAGTGGTCTACAACTTCACCTAGCGTAATACCATCCACACAGAAAATGCTACTGACCAGG
ACAAAGTTCCGGAATATATGTGGTTGTAGCAGTATCGTATTCAGGGCTAGCGGCAGTGGAATAACGAGCACCTCAACTAGCCCGAAATCAGCGTAGACGA
TCCCGAGCTGGTAGACCACGCATTGAACTACCAATGCGAGATAAAATCCGTTGagcatcaacagcatcaTCACAGTGAAGTGCCACGACTTGCGTGAAAA
CCAGTGAATTTTTATCTCTGGAGCCACCTCTGACTTCAGATTGCATTTGCTGTTCTTTGGTTCGCGAACCCTTTGTTGTCTCGGTAATTCGTACTGCTCC
TGAAGTCTTTGCATGACCAAAAGTGCTTTGCCTGCGTCCTCTTGCGTCCATGCCCGAGCTTCCTCGCACGCGATGGACCTGAGCTGCCTCTCCAAAGTGG
GTTGGTTTGCTGACATTCCAGCGGCCTTCAGTAATTGATGAACACACGAACGGAAGTAAACAAGAACAAGGgcgtgcagcgccagcagcgcccaGGAAAA
ACCAATCAACACAAGCACGAGACCACGACGTCTTGTCAATGCTGGCTCACCATAACTTATGCCTGCCGTGATCCCCTCTAACCCCCAagccacggccagc
agcagtgcccACATTGGTGCGCCCACGTCGGTCATGTGTGTGATCTGGTTATTCTGCGCCTGCCGAAGGTACTTTGCGAATGGGAagagctgcggcagct
gaaAGCGGCTGAGGAACAAGTGACGTAGCAAGCGCAAGTGAACTAACTCCCGTGTGTCTCGAGTCCGATCAAAAGTTGGCGAAGCCGCAGCATCAGCCAA
GTCCTCGGTGGAAAGCAGCTCAGCGCGATCCGCTTGGACGTTGTGTTTTCGCAGCACGAGAAAGATACAGGCGGCCTGGAGAATGAGTGCCAGCGCCAGG
ATGAAGATAGTCAAGTCTGCGACCTGGAAGGCCGTCATGGCAGCGCTGCTACTGTCTACGCTCGGCACTTCCTTGACCAGTTTGAGGCCGAGTCCGATGA
GTCCTAGGATCATGAGCTCGCGATACGCCTTGCTTAACAGCTGCTGGTACTTGGCGGAGACGGCGGCGCGTCGCTCCAAATGgtgcagcgcgcgctcgaa
cagcagcagacatACCACCAGCACACTCAGATGCAACAGCACGCGCCATAGTTCCACAGCGTCCCCCACGCGGAAGAGTGATGTGCCTCCCAT