Description :
From Genome Similarity Track
Location :
Scaffold_226:11132- 12417
Sequence
1285 bases(100 bases per row)
GGATCGTACCTTCTGAGCCACGGCAGTCCAAGAATAACATTAAATTTGTCATCCAAGTCCAATATGTGAAGTCATCATTATATTGGACCCCCTATAGTGT
ATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTTGCGAGGCGCACCATCATCCTCTTTGGAGGGATCTCGCGTTCGATACATTTG
AGCTCGCTGTTGTCTAGCTATTGGCATCGTACAAAGTTGTTCGACGCCTCACAATCGACTAGGGCTGGAAGCGACATATTTCGTGTCACTTCGAGTTTCA
AGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAAACACAATGATTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCGCTCGACGTTGCT
GGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTTGGCTGTCCGTTTCGTTGATGCGTCTTCGCATCAACGTCGGACCCACGCCTTGGGC
CCCGCTTGGCCGCTTGGCGGTTATTGTTTTCTGTGGTACGTGGTACCGCGCTCGGGGCACTGCTTTCACATGCATAGTGCCCTGTCTTCTGACATATATT
GCATTTTGCAATTTCTTGTAATTGTTAACACGAGAGCTCTCGTTCCTCGCGTTACAGAGGTTCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTTGACG
GACGATAAGAATTCGAATTCGTGTGAGCCTGTTTCACGCTGTAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCCAGGGTGTTGAATTCCATCCGGAA
CAGGTAGGTTTTGACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGATTCAGTGGTTCGACTGTTATGCAACTGGTAAGGTGA
CGTATGTACTGAACGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGATCCCTAAACTCCGCTCGAGGCGGCTCAAATGTTT
GCCTAAGCAGGGAATTGAAGACTTCATACGACCCAAAGACATATGGGTCGTGTAACTTCAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCAAAGTTCGA
TTGAGCAAATGCGATCTGCATTTGCTCAACGTCGATGTGGCGAGTCTTTATGGCATCGTCTAGTTCCACGAACCATCTCAACAGAGAGTCTTCGTCGGCT
CCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGGACGATGTGTATACGTCGACCCGGTAGCAGTGGCCTGCTGCTGTCTCA