Description :
From Genome Similarity Track
Location :
Scaffold_248:1113- 3704
Sequence
2591 bases(100 bases per row)
ATATTGCGAGATGAAGCCGGCAGACTTGCCATAACAGCGCGCAGTTCTTACTGCTCTGTCCACTCACGGATGTGTAATATTTTAAAATCAATTACACTTG
ACTTTTTGTAAAGTACTAGGTGGCCGAAATAGCCTGACGCAGTGCTAATATCGAAGGCTGTATGGCAGCCGCCAGTAGGCTTGGGAATGTCGCCCGTTCG
CACATGCACCACGTGGCTCCGCGTTAGCTTTAATACAAATCTAAACAGCGTGCCCAAACTCGTAAAATTAACTGAGTGACAGCCATAAATATGGGTGGTC
GGTTTAACCGGGCGCGGAGTGTATTGTTTAACAGACATGTTGGTCGGGTTAAGGATGCGCAAACGACTTCCGTATCAATGTTTACTCTCCGTTGAACAGG
CAATCCAAAAAATTTCAAAGAAGGGGTGTAATAGGTGCGTCTAAAACAGAATCAAATAGCGCCTTTCTCCGTATAGTCGGTGCTTTGGATGACGTGACGA
GCTGAGAGAAGATAGCCACCAGCCGAAACAAAGAAGGCCGTTTCATACCTAGAGTGGCTCAGTGACTCGATCCATAGGAGTACTCGAGAGTCGGCTATTC
TTGCTTGGCGTACTCGATCGTCGGTGGTTATTAGGCGAAATCCAGCAGCATCCAAAAGGAGTCTGAGCAAGTCGTTGTTTGTCAAAAGCTGCTGCAGGAT
GCGCCGCTCAGTTCTTCCGAAGACCATGCTCGATGTCCGTTGAGAATTCAAAAATGATAGGTCACTCGAGGAGGAGGATAGATCAACCTCGCATTTTTTC
GATCACGCAGAAAAAGGCACAATCCAGGGGCGGGGTGTGAGTGTGGTCTAACTGAAAGATGATCTTAGCTTCGGCTATCGACGGAAGGTCAACAAATATC
AATATCTGTTTAGTTAGCTGTGTAGTTCTGACGTTGCTGCGGGCATTTGCGGTTGTCATCCTGGGCGAGTTGTTCTCACACAACGTTGGGTTGCTGCTTG
CGCTTGCTGTTTTGCTTACGTTCGCTTTCATGATGGCAATTTTAGGCCGCTCAACAGCCGCAGACTCCGTCTGTTTTACAATAGGGTGATTTTCGTGCTT
GAATGAATGTGTGTTTGCATCAGAGGCGTGGATGCATCGACGAAACGCTCGTTCCCATGATCGCCCCGCTCTCCAATTTTCGAGCTGGATAGTCGCGCAA
CGTAGATAAACGTGGGTGATTGTCTTTCCCTTTAAGACCCGCTGAACTTTATACGGTCTGCTCAAAACGTGACGGTGATTCCATACTTCATCACGTGCTT
TTAGCGATCTCCAATGTGCCACCGAAACCGGTATTCCAAACGCATCGACAGCTTTCGAAATGGGGACGGGATTATCTCCTATCTCCGTGTGCAGCTCCCC
ATCCGTGTCGTTGGCGCTAGCTGATAAGGACAGTCTTGGTTTTTCTCGATAGCGGAGGACCAACGTCATACTGCAGAGCCTATTACAATATTAAATCTAC
TTCCTCCGTCCGGAAATATTAGCGGTCCAGCTGTTTAAACAGTGTCCTAAAAAAAGGCGGTATGCATAGAAATGCAAGTCATTTGATAGTACCGTCGTAT
TTCGACTAAGTACGCACATACAAACGTTGCTGTTGCTGTCGGTCGCAGACCCTAGGGGTGTTTTAAGCGTTCTACGTGGCACCGTGCATTAGCGAATCAC
AAGCGATACATTCCTATTGGTTTCTAAAGCATTTCAAGGTAAATTTGACATCCCCGCGAATAATTTTTAAATTTACATTTTCACCACGAACGTTGCCTTT
CGATTATGTTGCGCCCAGGTGGCCAATTTGCTTTAAACTTTGACAAAAAAAATCCACCGTAATCTAAACGGCAATTCAGACCAAACAGTCGCTCGTTTGT
TAGTTTCCTGTTTGTTTTTAAATTAGTTTTGACCGCCCATCCCGCTTATATTTGCGAACAAAGGAAGTATTTGTTTGACCGATATCATATAGCAAACAAT
AGGGTAGTATGTAAGCCATGCTGACAGCTCAGCATCTGTGCATAGAGTGCTGCTGCAATTATGATGAACCGACTTTTCACAAGCTGAGCACGGGTGTGTA
CATAAATGCTCGGGCATCAAGAATTCCGCTATACCACACTTCGTTTGTGGTGCTGTAAAAGCTGTACGCGCTTTATTTGGTCCGTGGTCGATGATTAGTT
GCTGCTATTAAAGTTAAAATAAAAATCAAAGGCTTATGCGTGGGTGTGTTGCAAAAGGGCTTTCGCGGGCCATTAAGACTCTCTTTAAACCTGGGTCGGG
GGAAACCACTTGCTTCAAACGTATTTCAATATTACGATAAACCCAATTTAAACGGGTAGGGCTATAAACCCGAAAATATTGGATTGCGCAACGTACTATC
CAAGTGCGATGCCATTCCTCTTGCTTTTAAAATCGGTGCGACGTCTGCCCCCGACTTTCTAGGCTACCCGCCGCGTACCGTACAAGACTGGGAAGCTCAG
CTAGCAGCTATTTTTAGTTTTGAAGGTGCCCAAACAAGTAAAACGTTAAACGTAAAGGGCCGGAAGGAGGTTATCTCATTCTCCCACGGGC