Description :
From Genome Similarity Track
Location :
Scaffold_3993:1113- 2536
Sequence
1423 bases(100 bases per row)
AGAACCATACTTGGGATCTTGTGTATCGCCCACCCGGAGTGAAGGTCGTCGGTCACAAGTGGGTCTTCGCACGCAAGTACGGTGAAAATGGTGAAATTAC
TCGCTACAAGGCGCGCCTGGTGGCCCAAGGCTTTCTTCAGACCCATGGTGTGGACTACACCGACACGTACTCGCCCGTGGCCAGTATGAATACGATCCGA
ACCTTCTTCTCGACGTGTGTGCAACGCGGCTACATGATCCGACAGTTCGACGTCGAGACAGCCTTCCTCAACGGCGAGCTCCAAGACACAGTCTATATGT
CCCCACCCGAAGGCGTCAACATTCCAGATGGTGTGGTGTGTCTGCTTCGTCGAAGCGTGTATGGCCTCAAGCAAGCGGCTTCCGTTTGGTTCAAGACTAT
TCGCTCGGTGTTTTCGAGTCGCGGTTTTGTTCAATGTCGAGCGGATCCCTGTCTTTTCCTTCGGCGCCATCGTGACGGTGACGACGACGCATCCCCAGTC
CTAGTGGTACTCTACGTGGATGATCTACTGGTCGGCTGCGCGACTGAGGCGCAAGTACAAGCCGTGCGCAATGACTTAGAGTCGCACTTCAAGATCAAGA
GTCTCGGCGACGTGCGTCTCGTGCTGGGTATGGAAGTCAGCTATGCTCGGGACAAGGGGGAGTTGACGATCAAGCAGTCGCAGTTCATCCACAAGATGCT
AGATCGTTTCGGAATGGTCGAAGCGAATCCGGTTCGAAACCCTCTTCCGATTGGCCAAGACTTGACACCCGATGATACCCATCCCCGAGTTGAAGACGCG
ACCAAGTACCGTGAACTGATCGGGTCGATGCTCTATGTGGCCAACTGCACGCGTCCAGATATCAGTGTGGCGATGTCTATCCTGTCTCAGTATCTTGCCG
ACCCACGCGAGATGCATTGGCAAGCTGCGCTGCGTGTGCTGCGTTATCTGAAGGGAACAGCGTCGCTCGGCATCCGGTACACCAAGCCCGACTCGTCATC
ATTGCTACTGCGGGCTTTCAGTGACGCGAATTGGGGTGGTGACAAGTCCACGCGGCGTTCAACTTCAGGTGTTTTGATCAACATGAACGGCGGACCCATT
ATTTACAAGAGCAAGCGGCAAGCGACTGTCGCTCTGTCCTCCGCCGAGGCCGAGTACATGGCATTGGCTCTCGCGACTCAAGAAGTGATCTGGCTACGGT
ACCTCCTTGAAGAAATCGGCGCCGTGTCGAAGGGCCCGACGGGTATCCATCTCGACAACCAGTCGGCCATTAGTATTGCGAACAACCACGGCTATACCCC
GCGAGCAAAACATATTGATCTTCGCGCCCATTTTGTCCGCGACCACGTCGAGAAGGCCAACATCACTGTCAAGTACATCCCCTCCGAGAACCAGCTTGCG
GACTTCCTCACGAAGCCTTTGCC