Description :
From Genome Similarity Track
Location :
scaffold_580:1112- 2583
Sequence
1471 bases(100 bases per row)
GCTCCCCTGAACACCCAGGCCTTCCACGCAGTCACATACTTGTCCTTCTTCTGGATCAACCACAAGATGGCGTGTTTCATTTTCTGCGTCTTACTTGCCA
CAGCTATCGATGCTAAACCAGCACCCCCCGCTTGTTTTGGTAGATACAGTAAATCTGGATTTATCTTGTGTCTTGACTTCTCCGATGACGTTGAGTGATT
CCACAAGAAATTCTTCTGTATGTTTCTGAGTTGCATTTCCGCCCATGGAGGAATATCAAACACTGCTGCTGTGAAGAGAACTGATGGTAGCATTATCACG
TTTAGGATCGTGATTCTGTTTTCCACGCTCGTTCCTAACTGAGCTGCTGTCGCTAGTCGCCGTTGCACATTGCGAATTCTCCCTGCCCAGTTCGGGGTGT
TCAATTCTCTTGTTCCAACCGCGTAACCCAAATACCGTTCTGTATCTCCATGAGCCAACACTGGTAGTCCATGATACTCCTTCATCTGAATGGCCGTGTT
CAGGAATATCACCTTGCTCTTGGTGGGTTGTACTTGTAAGCCGGACAAGTCTCCAAATTTGCGTAAAATCTCCATTACCTTCGGGATTTGCTCCGCTCGC
TCAAGAAATACTGTTGAATCGTCTACGAAGGCCGAGAATTTGTGTCGGTTCCCGGTGTCTTTTGGGATTTTGATCCCTGTCACCTCCTTGTCCTCCTGAA
CCGCTATCGCCAGTACTTCTGCTGCTAATATGAACAACAGCGGGGCTAGAGGACACCCTTGTCTAATCCCAGTTTCCACTGGTATTGCCTGCGATAGTTC
TCCATCCACTAAGAATTGTGCCGTCGTCCCTTTGTGCAGCTTTTGGATCATTGCCACAAATTCTTCTGAGAATCCAAACTTCTTCAATACCACAAAGAAG
AAATCTCTCGCCACTGTGTCATAAGCTTTCCTAAAGTCCAATAAGAGAATTGCTCGACTGTGAACTGGTGTCGTCTCTTGCTCCCCTTTTGCTGTTTCCA
GTATCGCGAGCATCATCATTACTGTCTTCATCATCTGCCTGCCATGTACGAATCCTTGCTGCGAGTCTCCAATCGGAATTCCAAGTATCCTTTGAACTCT
CACCGCTATCACTTTTGCGAACACCTTGTACCCTGTCTGCAATAAAGCGATCGGCCCATAATCCATCGCGTCTACTGAATCCCCCTTCTTCCGCAGCGGT
ATGATCATTCCTTCAAAGAAAGACTTTGGGGGTTCTCCACCTTGGATCAATTCGTTTGCGATTGTTACCATTGCTGGTACTTACAAAGCTTGGGTATCCT
TGAAGAAATCGTTGTTGAGTCCGTCCGGCCCTGCTGCTTTATGCCTGTTAAGTGAGTCGAACGCTTGTACAACTTCCTCCTTTGTTATTTCTTCCAGGAG
ACTCCGATTGTGCCGAAGACTTACCTTCCTGTCATCCGGGATGTGAACGAAGTCATTAAATTTCTCCTCCA