Description :
From Genome Similarity Track
Location :
Scaffold_1286:1112- 2188
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1286-fgenesh-gene-0.0GL21094

Sequence
1076 bases(100 bases per row)
GGACTGATTGATGTTAGCAACGCGAAACGACGTGCTCAATAGTATTATTATTGGCTGGGTTGGGTTGATTGGAGGATTACCTCTTTCTAATGTATAGAGG
TTCGCCGTTTTAGCTTGTTTATTGTATGCTTCAGGAGAAAAAGTATTTCAGCCAATCGGGCGATATCAACATAGGATTTTTACTCTGAAAGCCTAAACAT
AGTAGCAATTCGAAGCGAACGGTGGTTTTTGGGCGGCATTCTTCCTGATTCAACTTTTTTTGAGGGAAAACATCCTTTTTGTACGTATGCTTCAAAGCGT
GCCTTCATAAATCTCGCACACGCGAAACAACATGGGCAAAAGGCAGCGGAAGGAAGACGCGGATGACGCCGCGGACACCACCAGCACGCGCATCTACGAG
CGGTACGCCCCCATCGCATCTCTCTCTCTCTCGCGCGCGCACACATTATACTCTCTGTATCTTGTACTCACATCTGCTATTCTCTTTGTGCTAATGTCTT
TGGCGATGATGCCCTCAGCCACCAAGCGCTCATGCGCATCTACGCGAACGCCAACAGATCGTCGGTCTCTCAGCACGACATGGACGTGATCCGCGCACAC
TTCCAGTTCCTCCGCGACGACGACGCGGACGCCGAGCGCGGCAACGTGGACTGGCAGGTGCGCATGAGCGTGCGTTACTACCGCAAGCTCTTCCGCGAGT
ACGCGCTCGCGGACCTCTCGCGCTACCAGGAAGGCAAGATCGGGCTGCGGTGGCGCACGGAAGGCGAGGTTGTGTCAGGCAAGGGGCAGTTTATATGCGG
CAACAAGCAGTGCGACGCGCGCGCCGACCTACGCAGCTACGAGCTGCTGTTCGCGTACGTGGAGCAGAGCGAGAAGAAGCGCTGTCTCGTCAAGGTGCGT
GCCTGCGAACAATGCGCGGTCAAGATCTTTTACAGGAAGCTCCAGCAAGTGAAGGTCAAGAAGGAGGACAAGAGTGCCAAGAAGATCAAGACAAAGAAAC
GCTGGCGCCGTTCAGATTCGGACGCAAGCTCTGAATCGGATGGGTCCTCTTCTTCTGACAAGGATGATCACAACGA