Description :
From Genome Similarity Track
Location :
Scaffold_241:11119- 12815
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_241-fgenesh-gene-0.7Methylcrotonoyl-CoA carboxylase subunit alpha

Sequence
1696 bases(100 bases per row)
ACAGCAGGATGCACGTACTTGTACGGGTTCTCGGCGTAGATGCGCGCCTCAATGGCGTGGCCGTGGATCTTGAGGTCCTCCTGCTTGATCGGCAGCTCCT
GGCCGGCAGCGACCTTGAGCTGCAGCTCCACGAGGTCCTGCTTGGTGATGAGCTCCGTCACAGGGTGCTCGACCTGGAGGCGCGTGTTCATCTCCATGAA
GTAGAACGACTCGTCCTCGTCGAGGAGGAACTCGACGGTGCCCGCGCCGACGTACCCGACGGCCTTGGCGGCCGCGACAGCGGCGTCGCCCATCTTCTTT
CGCAGGGCTTCCGTCATGTGCGGCTACAATACAAACAAATAAAAGAATTAGCATGCAAAGTTGTCCAGCATGACCAGCTGTGGAGCGAGAGACTCACCGC
TGGCGCTTCCTCGAGCACTTTCTGGTGGCGGCGCTGGACGCTGCAGTCGCGCTCGAAGAGGTGCACGACGTTGCCGAACTTGTCGCCGAAGACCTGGAGT
TCCACGTGGCGCGGCTTGCGCAGGTACTTTTCAATGAGCACGCGTGCGTCGCCAAAGGACGCCTTGCCCTCGCGCTGGCAGGCCTCGAGGTTCTCCATCA
GGTCCTTCTCGTCGTCGACAATGCGCATGCCCTTGCCGCCACCGCCAAGCACGGCCTTGATCAGCACCGGGTATCCGATCTTGCGCGCCTCGGCCTGTAG
CGTCTCAAAGGTCTGGTCTTCGCCGTGGTAGCCAGGGGTCACGGGCACGCCCGCGGCGATCATGATGTCCTTGGACGCGCTCTTCGAGCCCATGGCCTCG
ATGGCCTTGACCGGTGGTCCGATGAACTCGATGTTGGCGTCAGCGCACGCGCGCGCGAAGAAGGCGTTCTCCGAGAGGAAGCCGTAGCCCGGGTGCACGG
CCTCGGCGCCCGAGAGCTTGCAGATCTCGAGGATCTTCTCGTAGTTGAGGTAGCTCTCGTTCGCGGGCGCGGGGCCGAGGCGGTAGGCCTCTGTGGCCTG
CTTGACGTGTTGCGAGTTCACGTCCGCGTCGCTGTATACGGCGACGGTCTCGATGTTGAGCTTCTGCGCCGAGCGGATGACGCGCAGCGCGATCTCGCCG
CGGTTCGCGATCAGGATCTTGCGGAAGCTGCGCGGCGCAGTGGCAGCGGACGTGGACAGCAAGCGGAGCGCCGGGGCGCCGCGCAGCAGCTGCGACGTCG
CGCGGGCGGTGGGGCGGAAGAGGCGCATGACGGAGCTGCTCGTGAAGCGTGTGGTCGGTACGATTACTTTGTGACTTGAGATTGTGGCGTGTTTGAAGGG
ATATCTCTCTACAAGAGCAGGAAAGACCACCAAGTGTTCTTGTAGCGGGTTGAAGTTAACTTTGGGTCTTCCAAACAGCAAAGTCGAAAAATGAGCCAAC
AGGTAGAAATAGAAATGAGGCTGTGAGTGTATTTTGTTTCTAATTTCGTTTCTAAATGTGTCGACGAAAAGCGACAAAGAAGAGCCGACTCAGAATTATC
AGGAAATTTGATAAAACCTGATGAGCCAGGACGCTCGAGTCGGTACAGCGTTGATTTTGCTTGCATTGCTGTGCTGATGGTGAGTTACAAGCGAGGTCGC
CCAGAACTAACAGATTGCGTTCACGCGAACACGATGTCCACTTCGGAAGCACATGCGGCTATGGACGCAGCACTCGGATGCGCTTTGCCATCTGCT