Description :
From Genome Similarity Track
Location :
Scaffold_411:11119- 12222
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_411-fgenesh-gene-0.2Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_411-snap-gene-0.11Gene of unknown function

Sequence
1103 bases(100 bases per row)
CGCGTCGACCTCACGGACGACGACGACTCGGACATGTCACCGTCGATTGAGGCCGAGTTGAATCGTCGAAAGCAGCAGAGTGTAGTTGTGATGGGGCCGA
CAGCGAGATCTCAACCGCGATCACGCCCAACGTCGGCAACACATCGGCGTCACCAGCATCGTGATTCAGACAGGATGGCAACTTCACAACGATCGTTTCA
ATCACCCCGGCGGTCGTATGAGGTGGCGTCAGATGACCAAGACGCGCGGTACGCTAGCACAAGTGATGACGAGGAATCGGAAGAGAACCGATACCTGGCG
ACGGAACGGCATCACCAATCGATTACCGACAATGGAGTGATCGCAGCACTGATCGACAATCAGCAGCGCCGATTCCAGCAAGCGCTCGACAGCTTGCGTG
AAGAGCGCGTGCGAGAACGCGAGCAGAACCACGCGTTCTTGATCGAACTCGTCAAGCAGCGGGTTCCTGAAGACAACAGGGAACATGTGTCGTTCCTCAA
AGCACTCGCGGAGCGACAGAGCCAGCAGTTTGTCGACCTGTTTGGTCAGCTCCAGAAGGCTCGTCAGCATGAACGCGACCAGTTCCGCGCTCTGCTGCGT
CGGCTTCACCCTCGACCTTCTCGCGACACCAACGTGGAAAGAGCTATGGGCAATTGGCCGGCTGCAGCACCCACGAGCAGGACTGCGACCGGGCAGTAGC
AGGAGTCCGACAGCGTTGCCCCATCAAGTATGGTTGACTAGTTGTCTATCCTGCACGTTTACACCCTTTGACGGAACTATAACAGAATCTTTTGAAAGTG
CATCCAACGTCACAGCTGGGACCAGGGACCAGGCAGGCGTTTTGCACAACGGTGTGCCAACCGCCGCAACGCCCGCTGAGCATTCTATCGTCATTAGTCT
GTGTCTTGGCGAGTCGAGCCTTTTGCGATGGCGCAGAGCGAGCGTGACACAGCGCGATGGACAAAGGACGAGATCTGGGATCTCATCCGGTCGCATCAAG
AGGTCGAAGACAGACTCTTGCTGACTCGACACGGCAAAAAGGGCCGACCGAATGCGCTGAGGGAAGAGCTGCTCGACTCCAGTTTCACAAACCGCGGACA
GAA