Description :
From Genome Similarity Track
Location :
contig_109:111181- 115903
Transcript NameFunction/comments
g13177.t1hypothetical protein

Sequence
4722 bases(100 bases per row)
AGCTATATCTCGTCGTGCAAGTCCTCAAGTTTATTTAGTGACAGTCGCTGCCCATTGGCCTGTTTAATAATGCAAATGATATCATCAGCAAAGCTCGGAT
CTCAATTTTACCGCTTCGAAGTAGTTCGAAGTACTACGTAGTCGGATGTAAGAACTAATGTATATAGGAATCTCGTGCCATCGGTTATCATGACCAAGCC
TGGCAACTTTCCCACCGACTTGCGGCAGAACTTAAGTACTCGATGAACAACGTGGTTTTGTCGTTCATGATCTGTGAAACGCGCGAGGAAGTCACTCGCG
GTATAACGACGACGTGCAAAGGCTGACTCGATGGAACTCTGTACATTTAATGCAAATAGAGCAAATGCTTCAGTCTGTGCAAGTTCAACGACGCATCTTC
GGTGCAGTGGCTCGGGCGCCCCCCGCGAAAGGCAACATATACGGCAAGGCCCACCTGGCGTTGTACACGGGAGGACAACTGCGTGGGCCCCCACAGCCAC
TTCCCGATCGAGTTCAATCACGACGGGAGCATTCTTGTGAATTCATCGGCGAAAGATCTGAGCCACTACGACGACATCCCGCCTTCGTGGTCGGGGAGGC
CAGCGAGAACATCAAGAACTGGGGATCGCATGGATTGTGCGTGGAGCTAGCAGTAGCAGACTATATAGACGGATAAACGCGTATGGTACTGTACTGCTTC
TCATCCTTGACGCGGTACACGAACGTCACTTCGTGATTGACGTCCCGTTTGCCGAAAGGTCGCGGAAACGTTCTGCGATTGGCTGAAATGCGGGCTTGAG
TCGACGACAATTGGATGTAAATGCCCTGGAGGGAATTCAGTGGGACCTGCAGACGAATTGCAGACGAATGCAACAGAGACCACGAAGGCCGGCCTTTCTG
CATGGTGCTGTGCGCTTCAACACGCATGTACACGAGGCAGCGGCGGGCATCGCTTCCCAGTAGACTCGTGTCCCCCCACGTCCAGTTTAGGTTATTTAGG
AGTGATTTATGCTATGCTGAATTGGCACCGCTCGAGCGCGCTGTTGAAAACGGACCTGGAGCGACACCACGATGGATGGCGTGGGCGTGTGTGATCGCGT
GGATAGTCATGGCGATGAGGATATCCTGCCGAGCGTGTTGTCAGCGGGGTGCTCGCTCATGACGTCTGCATCACTATTAATATAACGTTGGTAGACTTCC
CTCGTTCTATTGCTTGAGTCGTTCTCGTTGAGATCTTGTTGACCTGCAAGTGCGAATGGCAAGGCAAGGCTGCTACCTACAGCCGCCACGACCTGCTTCG
GAGAGACATAGCTACACCAAACGTGCTCGCCCAGAACGCGTAAATCAACAACCCACCTTATTAGTTCTTACACTTCTCTTCTGCACCTGCTTCTCGGCTA
TATCACACCCGTGGAGCAGCTCCAGTCGATCTGATATCCTGCGCTACTTGTAGCGCTCTCGTTGCCACGTGGTCACCCCTGTCCCTACTGCAGCTCCACG
AGCCTTTCATTCGCGTTTCCGCGTTGACTGGATCTGGCGCTGCTTGAGCTGGTGCAGCCTTCGTCCGCGGGGCAACAGCCACTCGACCAGCACAAGATAC
GCCGCCGCCAGCAACAGCACGGCGCCCGCGAGAACCGGCAGCCCGCCCAAGTGCGCCACCGTCTCGGCGAAGGTCACACCCGCATCCCCTTCAACGTCTT
GGGCCGTTTGCGCCGCGGCAGCCGTAAGCAGCAGCGTCAGGAACGGCACCGTCGGGATCCCCATCTCGCTTGATGTTAAATCCGATAGCAGATTTGAAAG
GGGGTATTTTGCGGCTGGGATTCCCCTGGCCCTCACCCTTCCCTACCTTTTCTCCTCCAATCAATTCTCTCCATATGTACCGAAATGATGACACCTCGTT
CACTAGCTATTTGTATGTACGACGCGCCACCATTAAGGGGCTTCTCCCTTCCCTTCCCCTCGCACAATTTGAACTCGGTCGGCGGAGCTCAAGCGCGCGG
CAACTCAACTCGAGCGCAAGTAGCAGAAGGCGCAGCCCAGCGGGCCAGCAACTGCAACAGGAGGCTGCACCCCACCGCCCGCAGACAACCCGCGCCAACT
CCCGGTACGATAGCGCGTTCAATCGCTGCACCACGGCCAACATGCTGCGGGATCGACACGTGTGTTCACAGTGCCTACCAGCTGGGCGAGCTTTTTTCGC
TGGGATTTCCAAATTGACATTCACTCTTGTCCCCCCCTTTCGCAGAACCTCAAACTGCGCGCCAATCCACTGCAGTTTGAATTCCCACACAGCAGCGAAG
AGGTAATATTGTCGCGACCTGCAACCTACGCAAAAGGAAACTTGTTGCAAGCTACCTTTGCATGTCAACAGGGAAGGTGTCGCATCAACTGACATGTACA
TGCGCGTGTAGCCTCTCAGACGACAAGGAAGACAAGGGCGCTTACGGCTGGCTAGTCAAAGGCAACATCCATCTTTGCGCTGCTGGCGCAAATTGTTTGT
GGCTCAGAACCGATTGCGGTCGAGGACGACAACCTATTTTTAGGACCGGCTGGTGTGTGCGCGAAACGGCGAGAGGGGGAGAGAGCGAAAGAGACCAGTG
TCTCAACGCTCGAGTTTTGTGCAAGGGTTCGGACGAGCTCACAAAGCAACCACCGCCAGTGACCAACGAGTAGGGGACGCCGCCGGTGTATAGGTGACGG
AGCGGCATTCTTCGAGCAGACCCCACAACCCGAGCGCTGACACAGAACCGCCGCGGGAAGGGGCAAGCGAGTGACGAGCGTGTTGAGGTGAGTCTCGACT
CCTTCAGGCCGCGATTTTTTTTGCGCAAAGAGTTTCCTCTTCGCTGCAAACGATGCAACTTCGCGCCAACTAACGTGTCCTCTTTGCGTACAACTGCAGA
CTCGGTACCCATCCGCACAATGCCGCGGCCGCCAGCAAAGGCTAGTACAGTAGCCGTGAGTGGCCAGCAAGCGGCTGCACCGCAAACGGTGTCGCGCCTG
CAACAGCAAAAGGAAGAGGCGGAAATGCAGCAATTGCAACTGCAACAGCTCCAGCAAATGCAGCAGCTTCAGCAGCAACAGCACATGCAACAACTACAGC
AGCAGCAAGCGCAACTTCAGCAACAGTCGCTGCAATACCCGCACGGGATGGGCGCCGCCTCAGGCACATTGGGACAAAGTGCAACAGCGAACAACCTCGT
GTCCGTTGCAGTGCAAGCTGCAACAAACGCTGCAAATGCAGCCGCCACAGCCGGGGGAGCCACTGCAGGAGGAGGCTACGCGTTCCCGCGCAATTCGCCA
GAATTTGCATGCGAAAACGTGGGGGAGCGCGTCAAGGGCAAGCGGAGAAAGTATTGTCCCCACGAAGTCACAGCGCTCGTATTGGGCGTACAACGGTATG
CAGACGACAGTTGCCCCTGGAGTTCAATTTTGCGCGACCCGCATCTGGGACATTTGTTTCACGGACGCAGCGGAGTTGACCTCAAGGACAAGTGGCGGAC
GCTCATCAAGACCCGCCCGGAGCTGGCCGCGTACACCGAAAACCGCAAAAACCACCGCAAATATCGCCCTTTTTCCGCGACCGAAGAGCGAGCCTTACTA
GAAGGCGTCAAGAAGTACAACGGACAGCGGAACGTGTGGTCGCTCATCCTGATAGACAAGGAGCTCGGGCCGCAGTTCAACGACAGGTCAAACGTGCAAC
TTAAGGACAAGTTTCGCACGATGCGGCGGGCAGGAACGACGTCCTCACTATTGGTCAGTGGAGGGGGTTCTGTACCGGTAAGTCGGCGGACGTCGGCCGC
TTCTACCCCCACATCTAATAGTCCGACGAGCACCGGAACGTCTACCTCGACAACTGTTTCTATGTCGAGGACACTCCCGCCCACGTCTTCAGCATTAACT
GCTGCAGTTAACGGAGCGAGCAGAGCACCAGCGACCGTGACGTCGGCGAGCCAACAGGCTGCAACTTTGTTAGTGCAAAACAGCAATGCCACCTCGGCGA
TGTTTGCAGACCCGAACTTGTACTTGGCTGGAGCGTACTCGCTCCCGCCGCAGATGTCCCAAGGCATGAGCATGCAGCACATGACGTCGACTCAGTCGCG
ACAACAGTCGGCACAAGCCCACGCGCAAGCTCAGGCACATGCGCAAGCTCATGCCCACGCACAGGCTCAAGCTCAAGCTCAAGCTCAAGCGATTGCGAAT
GCACAAGCTCGCGCTGCGCAAGTGCAGCTTGAAGCGCAAATGCAGCAGATGCGAGGGCAGCACGTTTCGATCAAGCAGCAATATCAGGTGAATACCGCGT
TCAGCACCGGCATCCCAGGCTACCAGCTCGTCGGCAATCAGATCGTCCCGCAGCAGGCTTTATACTACCCGATGGCGCAGAGTTCGCAGACGCAGCAGCA
AGCACAGCTCCACCAGCAACAGCAGCAGCAACTACAGCAACAGCTTCAGCACCGACAACTTCAGCAGCAGCAGCAGCAGCAGCAGATCGCCGCGGCGATT
GCAGCTGCCGCAAATCCCCAAGCCTCACACCAGCAAAAGTCGCAGCCAACAAGCTCCGGCCAGCCGAGTGGAACCTCACGAGGTGCGTCAAATAGTGACC
GCGGTCGTGGACGTAGTCGGAATGCGCTGTCTGACGAACCCGATGATGCGAACAGTATAAAGGAGAAAGGGTCCTCAGTGGAAGATCTGCTGATGCAGGA
GCTGTAGCGTCTTCAACGGGTA