Description :
From Genome Similarity Track
Location :
Scaffold_234:11118- 12306
Sequence
1188 bases(100 bases per row)
ACAACCGATTGTACAGAGACGAACGTCGACGACAACTGCAGCAGCGTTTGGATGAAGCGGAGCGCGTTAATGCAACACCAGCGGGGGATGGATCGCCTGC
GTCGAAGCGACGGCGTACGAACCGAAGGCATCAGGCATAAAAACGATTTAGGACACGGGTCCGAGAACTCGACCTGTTAAGTTAGCAGGTGAATAACGGT
TCGTTTTCAGAAAGACAGCACGTCCCAGTGACAATTGCAGTCGCTCCGGCGGCGGCCCCAACACTGAGCACATCCGGTGTCGCAGCAATACGGATGAGTG
ACGCAGAGAGAGCCCGATTGCGCCGAGCAAATATGATCTCTTCCCAACGCGAGCGCACTTGACAAAAAAATGCAGAAAGACAGCGGCTACAAAGGGCCCA
GAAAAGAGCAGAAGAAGTTGAGGCTGACCGCGAAAGAAACCGAATTGCGCAGCAAATCCGAAGGGACCTTCAGGGTGAAGCTAACCTTGCAATTGACAGT
GAACGGCAAGCAACACGACGCTCCCAACTTTCCCAGCAGGACCAAGACAGCGGGCGTCAAATAAACACTAAAGCCCGAGCTCTTCGTCGCTCCCAGCAGA
CCGAGGACAAACGTAAGGAGGAGCGTGAAGCGAATGCTGTGGTTCAGGCTACGCGACGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCCCTTTCCGTCTACGCCGTAAGCAGTTTCCGGT
GCAACCAGCGTTTGCCATGATCAACAAGGCCCAAGGACAAACGGTGCAGAATTTGGGGTTGTATCTGTCAAGTCCTTGCTTTTCCCACGGACAGCTGTAT
GTGGCGCTGTCGAGAGTGACGGCGCGGTCGAGACTCAAGGTGATGATCGAGTATCCCGAGCACGTGGAAGACGACGGAGCGTACACGC