Description :
From Genome Similarity Track
Location :
Scaffold_356:11116- 14345
Sequence
3229 bases(100 bases per row)
ACCGCTCGCAAGGCCCTGCTCCACGTGCTGTCTTCGCGTGATAAGTATATGCCTGGGTATCGCGCTCGTGCGACTTATGCTCCTGGCCAGTTTTCGCCGT
GGTCGTCTCGCTGCTTAGGTTTGGTCACGGTGGGTGGAATGGATTTGGACTTCTTGTTCCGCCACACTCTCGTCCCAAGCACTACTTGTTCCCGTTTCGA
AACCCCGCGCTCGCCCGCCTATCGAGTCCCAATGATCACCACGACTGGTAAACACGGCGCAAATCACCACTTTATACGGTCAGAGACCATGGGACATCCT
GGATCGGCCGATGGCGCCTGTGTATTTTTCGCCCGACTGGCTGGTTTCAAGTCTTGGTGACTGACTATCATGATTTTAAAGATCATCACCGCCAGGTGCT
ATGGGAGTCCACCCATGTGCAACCAATCATCGTCGGTCCAAGCCGCGCAAAGAATCCCGGGTTGAGCGTCTACTATGAAGAAAGGCGTCGTCGACGTTCC
CGATCTAGTCCCCGGTGGAAGGCAGTGCTCCGGATCGTGCTGCAGGGGTTGGTCGAGGGTCGGTGCAACCTCGACATCCTGTTAGACCCTTTCTTCCTGC
AATTTTCCGGACGCTTGAAGAAATGCCTGTGACATCCGAGTTTTGGCTGCCGACAAACCAACATCCCTAATTTGGCCTCCGCCTTGCGCCTGACGGACTC
CGCCGGTCCCTGGCGTAATCAATACCGGACGGCCATCGCTGATCACCCGGGATCGTCCATCGACCGCCTCACAAACAAGTTCGTGGAGAAGTGATTGTCC
GTTTCTGGTATAAAGGACCATGGTGTTTATGGCCGCAGTCATGACCGCATGTCGTAACTACTCAATTCGCCTTTGTTGCTCGTTCCATTATCGTTACGTT
CGTTAAACATGTGAATCCTCCCCTTTGCCAGCTCGCATGGTCATTGTTGCTTTCCGCTCACAAAGCAGACGATCACCATTCTTCGTGGTCGAGGTAAGCA
CCTCTGGTCGCCCTAACATCTGAATTTTCTTCGTTTACTTGCATCACTTCATACCGATTCCGATTAGCTCGATCACGTTCAAATTCCTGCAACAATGCAC
CACAGTTGAGGTTCGCTTCATCCACCCTGGTTTCCTCCTTATGGCCCTTCCACCGGACCAGGAACTGTCAGTGTGTTCTTCCATACCGAGTTTCTCGCCC
CGACTTCACATCTCTAATGCTGTCCACCTCTTATTCCCCTTCGGCTAAATTGCCTTTCCAACTGTCCTCCGGCTTCATCAAAATCCACTCGCTCGGTTTC
TTCCACCTCCAGCCGTGCAACAGGTTGGTCAGGAAAACTTCGTACCAATTTTAGCTTAGGTATGTGCACGAGCGGGAATAATCGGTATGGGTTTCCTTGC
ACTTCCAGCCGTACTGCATGTTCCCCAAACTTCTCGATCACCCGGAATGGGTCATGCCACATGTGAGCCAGCTTCCTGGCATATCCTTCTTTCACCCGAT
CCAAATACAGCCACACTTGGCTACCACAGCTTATTCCATGTGGCCCTTGATCAGTGTTGTGTTGATCAGCCCGGTCCTGAATAGCTTCGTTCAGCCGGTC
ATTCACGGTGGCCCGGGCACGTTGGTACTGTCGCTGTATCTGATAGCGCCATCTCCTGGGGTCACGATCACGTGTTTTGGTGCATCCCAACGGAAGGGTT
GCTTCCAACGTCGATCGCGGGTCCCATCCGTGGATGGGATAGAACGGGGTATCACTTCGGAATCGATCATGCGCCGTATTGATGGCGAAGGTCAATCGCT
CGGCGTACTCATCCCAATCTTGTTGGTTCACGTCCGTGACATATATCTTGAGCGCCCTGGTCAATGTTTGGATTATCCGTTCGGCGGTGCCATTGGCCTG
AGGCCGATACGCCATTGTAGCACGCTGCTTTTGACCGGCAATACGGTTGAATGCGCGAAAGAAATCCGACATGAACCCAGGTTCGAGATCATAGCGCATA
GATTCGCTCGCCCCAAATCGCCGGAAGACGCATTCTTCATACCCTTCCGCGGTCGTTTAGGCCGTCCTCGACGAGCTAGCCTTAGCGATCACGTAGCCGG
AGACCAAATCAACCCAAAGAAGCAATTCAGTGTTTCCTTTGAATGACCGGGGCAAAGAAGGGATATGATCCACTGCGATAATCTGGAACGGGTACGTAGC
TTGCATGTTCCCCGGGGATTCTCCGCGTAGCGCCGGACATTCCTTCCCGGTTTCGCAGTCGACGCACTTCCCCACATACTGCCGCACGCTTCTGAACAAA
CCTCTTCAATGGAAGTGTGATCGCACACGGTGATACGTGCGGCCTACCCCTTGGTGACCACCTTCCAGAATTTTGTGGTAGTGGTGTAGAATATCATCTT
GAAGCAGCTCCAGGATTACCAAACGAGCGAGCTCAGCACGGTCATCGGGGTTTGTTGCCGATCGTCGGCAAAAATACAACAATCTGCCTTCATCTACAAC
GTAGTCTGGGGCAATCACGGCACTTGCTTTTGCTTCTGTAGCACCCGGTTCCGTTACATCTCCGACTAAGTAAAGTTTGAGGTTAGCGATCCAACTCTCT
TCGTCTTGCACATGTTTTATACGGTCGAGTCGCATCTGCTGTACTACGTCATCGTGTATAATAATAAACGCCTCACGCCTTCGCATGATCGATCGTGTAA
TTGCCGCCACCTTGATCACTTGATCATTGCACGCTGGAATCATAAATTCGTCCAGTCGATTTATGGCGCTCAGATCGTGGAGCTCCTGATCCGCTAGCAT
AAACATGCCCTTTTCCTGCTGTAAAGCAGTGCTAGCCAGTCGATCCGCACTGATTCCATTCGCGCTTAACGTGTAAGAACTCATGTGTCGGCCACGACCT
AAGTTGATATATGGATTTGAGGCGCAGTGATTGTAACCTTGATGCCTTGCAATCAATCTCGCCCCGCATCTGCCTGTTGGCCAGGTTGGAATCCCCACAG
ATGACCACTCGTCCCCTTGTCTGTTTCGCTAGCAGCTCGCTACTCAGCAGTAACCCGTGCTACCCTGCCTCGTTCACTGTTAATCGAGTATCAAAACGCG
ACGCAGCTGACAATTTGGTCCACTCGGGCAATTTCCATATCACTGCACTGTAGGCGCCCCCTTTTTCTTTATACGTGCTGACCCGTCAGAGCTGAAGACC
AACAGCACTTCGACATGTCTGACCGTAGG