Description :
From Genome Similarity Track
Location :
Scaffold_509:11116- 13965
Sequence
2849 bases(100 bases per row)
CATTCATCCTTCAGGATGATTTCCACCCGCCTAGCCCACGGTCACTTTTCGATGCTGATTCTCAGGGTTGTCGGACGGCCTTAATCAGATCCGACAGTTT
TTCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAAC
GCATTACCTTTCCCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATAT
CATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCTCCGCCTTCACGGTAACC
GACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACC
CAGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATC
CAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGC
GTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGA
GTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGAT
TCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTC
GAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCTATTTCTCGCCCCGGGTGACC
CACAGTCTTTCATGTTCCGCCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCGTCATCT
TCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTTACTCCAGCTGGTAC
CATGAAATCCATCCCGAGGATGGCGTCTTGGCCAGCGAGATCTCCAACCCAAATATCGAACCAGTATACCAAACAACCTGCCAGCGTGATCGTGATCCGC
ACTCTTCCATTCGTACGGTACACGCCTTCACCAGTCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTAT
CTAGTATATACACCTCGGTACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACTTTAGCTTGTCTGAACCACTTTCCTGGGGC
ATGGTACTTCCAGTATCCACGGACTCCCCTGTCAACAGATCCACGGGATCCAGTGACCAGACATACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTA
GGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGATTTCGGATCTGGCAAATTCAT
CCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTACTACCTGGATCTAGCGATGT
CTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAACACCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTG
GCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTCTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACC
GCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGAT
CCGCGCTGCGAACAACTGACTTGTGCTATCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGT
CTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCGAACCGTCGGATCCTTATTCAGTTCCCGA
GTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGG
TGTTTTGCGCGATCCACCGCCCGCAGCACTTCTTCCAGATCATCTGCGTCGGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCATCTCCCAACGTC
TCGATGAAATGATCCACATGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGGCCGTAGACCGGCCACATTTAGTCGATGTAGGTATT
CCAGCGGGGATTCATAAAGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATACACAGTACTGGGTCTGGAAGCTTGCGCAGCAAA
TCCGGCCACTTGTTCCTGATGAATCTAGACACAGCTGCCGGAACCAGTT