Description :
From Genome Similarity Track
Location :
Scaffold_281:11116- 13434
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_281-fgenesh-gene-0.2GF15935
Pytiw_DAOMBR242034maker-piw_contig_281-fgenesh-gene-0.3Guanine nucleotide exchange factor

Sequence
2318 bases(100 bases per row)
CAAAGCTTCAAGTCCGAAAGCGTCCCGCCCGCGGGGCTCCAACGTCCTTTCCTTTGAATCGACAGCGCCGTTGGCATTCTTCATTTCAAGCTCCAGGCAA
CTGATCAGACTGACGAAGACATGCAGCGAGCGTCAGAGAGGAGCAGCTGCGCCGTGTGCCTCGAGGACCTGCGCTCGGACCTCGTGGCGCTACGCTGCGG
CCACGTGTTTCACCAGCCGTGCGCGGCCCACGCGCTCGATCTCTGCGCTAAGTGCCCGATCTGCCGCACGAAGACGCTCACGAAGAAGTACGTGCGGCTC
TTCTACTTGGCCGGAGATGAGACGACCACGAGCAGCTCTCTTGGTGCGAGAGCTCCGCCACCATCTCCGGTGCCAACAATGCCTTCGCCAGCTCGTGGTG
GTGCAGAGATCGAGTCGTCGGAGCAGATCGAATTCTCGAGTCGCTTCGCCGAGCTCCAGCTGAGCCTGAGTCGCCTGACCGTGGACCAGCGCCGGATCTC
GAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCCGCCTGCAGA
CCGAGAACGCGCGCCTGCGACAGGAGAACGAGCGCGCTTGCGACCAGCTCGAGGCCGCGCGCAGCAAGCAGGAAGAGCTCGTGAAAGAGCTCGGTGTCTG
GAAGCGCATCTGTGCGTACAACTAGCTTGCCAACTGTACCATCAACTCTGTGATACTTGTGCTGACTCGTTCTAACATTGTTGTTTGTGTGTGTTTGTTT
AGCAACCACAACGTACGCTCAGCTCCAGGCTCTCGTGCACGAGACGAGCGGGGCGAACAAGCGCCTGCTGGCGTCCATGAAGGAGCTCACGCGCGAGCTG
CTCGCGCTCTCGTTGTGCGCAAGCTGCGAGGGCGTCGCGCAAGCCTCGAGTGCGCAATTGCAGGAGTTTTGCGCGACAGTCGAGAGCAAGACGAGCGGCA
CGAGGCCGAGTCCGCGCAAGTCCATGGCCTGTTGCACGGCCGATGGCACGTCACGGGCGCTGCGTGGCTTTTGCGCGCGCCACCACTCGAGCGCGTCACT
GCAGCAAGCCGAATAAGACGAGGCCGTGCCACCACCCGAATCAGTATTGTATCTCGCTAGTCGTGCATGTTGAAGCCAGTTGGTGAAGGTGGTCCCCACA
TACCACAACATGTAGCCATGTGCTGTTTGCTTTGTGTGTGGTGGTGACGTTTCATACTTTGCGTATATATTTATATCGCTACAGTGTTGTGGCTCTGCAT
ATCCCATGCACATACGGTCTGGCTTGCAAGTCTCAGCTTAGACGCAGTTTGTCAAGCAAGTCGTCGAGCGCATACACGCCATTTCCTCGTCGCTATTGCC
TCGGCGCATTAGCAAGGAGCTGTCGCCATGAACGACACGATCAAAGAGGGCGCTGTGGCCGTGCGCAGCCACTTCCTGGTACGCTTGTTCAGACTTGATA
GTTTGTTTGTGTGCTTGCTCACTTGTTTGCTTGACCTGCTAGTGGCGCGAGCGCTTCGTAGTGGTCCGGAAGGGCGAGGTGCTCATCTTCCGGCGGCGCG
ATGGCTCCATGAAGAACCGCATCGACCTGCTGCACGCGAGCGTCAAGCTCACGTTCCACAGCGACAACGCGCATGTCACGGTCGCGCACGCGAGCAGCAG
CGGCAAGGATTGCATCCTGGACTGCCACACGACCCAGGCGCGCGACTCGTGGCTCAGCGCGCTCGTCACGGCGCGTGGGCGTCTCGAGGTGGACACCGAG
TCGGACGTGATCCTCTCGGGGGACGACAGCGACGACGACCTCCCACTTCTCCACGAGGAGGACGCTATTGTCCACCTGAGTGCGACGACGAACACCAAAG
CTGAGCTCAATGGTGATAACGAGACCGAGGACGACGACGAGTACAGCGAAGCCTTGTTGGCGTTCCAGGACGTGCGCACGTCCATGATCGCGGCCCACTT
GACCATGAGCACGGCCAAGGAGGACCTGTTCGTGGCCCCCGATGCGTCACTCCAGCGCAAGCACCACCACATCCACGCGACACGCGCCGAGGAGCTCGCG
CGGCTCAAGTGCATCCGGTCGATCCTGCTCTTCATCGAGAGTGTGCCCCACGGCGGCCGCGTCATCCTGCTGCACCTCGGCGTGCTCGCCTCGGCGGGGA
TCAAGATCGACGACATCC