Description :
From Genome Similarity Track
Location :
Scaffold_49:11116- 12839
Transcript NameFunction/comments
Physo_136864hypothetical protein

Sequence
1723 bases(100 bases per row)
CCGGAAGTAGACTATGTCTGCCGAGACTTCTAACACGAAGAAATATTAATTTGCAGCCTTATAACAACTGTACGGTGTAGCTGGTTTTGGCAGCGACAGT
TTTGCAGCGTATTTCGCGCCACGTAAATGCCGGATTGGAAGCAAGGGCATGGAGTAGTGAGTAAATAACCTTGATCGTGCGTATATCCCACAATGACCTC
TCCCAATAACTAAACTAAGATGACGAGAGTATCCTACTACTAACCAACTTAAGCACGACGTATACTTCGGTTTCGCCGGGAACGACGGAGGTCTGGCTCG
TACGCGCGTCATCAACTAGTCAATCCGATCATAACTCCTTATTTGTGCGTATAGAGATCCTCTTCGGCTGTTTTGACAGTCTCCGTGTACGAGGCGATTT
CTATAGTACGCGAAGCCCGAGTGCCGCTACCGGTGCGGCCACCCTCGATAGCAGCATCAATATACCTGCTGCAAATTAGAATAACCGTGGAAGGCTTAAA
CTTTTTCTAGGAACGGTAAAACGAAGCAATTTCAGCATTGCTTCAGTGTTCCGGATTGAGAAATGCCGTCGGTGTAGGCCGTTGCCTCGGCAACAACACT
CTATAGAAATGGGCGAGCTGTAGGGCATATATCGTAAAGCTGACAAACAAAGCGAAGAAGTGAAGCTGCTTCTACGGTTATAGAACGGCTTTAGCACTGA
CATACAAAGTAAGTCAGCACCCCAAGTACTCCTTTGTTAGTTGTAGTGATTACCCATTTTTCTTAAATGGGATACGGATAAATATCGTGACGGTGCCGAC
ACAATTTTTTTACTTGATTATGTATAGGCAGACTGACCGCAACGCACGTATATTGACCAATGACATCTAGATTTACCCAATATCGGCCAATGAGTTTGAT
TAGGTGTGGGGTAAAACGATGCCGACGCCGTGCCGACGTATAATGTAGGCACGGGAGCAAAAATATGCAGGGCGTCAATACGAGCCACCAGTCTACTGCT
CATCACTCGAATATCTGCCCTCTTGCCGACAGAACATTCGGAACCAGTATGAGCCTCCAAGACCTCGCCCCCGTCAACTCCCAGCGCGCTCTACAAACCG
CAATCAACGCGTTCGGGCGCTTCGTCGCGGCCCAAGGCGTCTCCATGGACTTCATCGCTGCCTCTCTCGCAGATGATGAGAGTGAAGCTGTGTTTGTGAA
GCTCATGGACCGCTTTGGCGTTCACCTCGCCTTCGTCGAAGGCCGAGGAGGGAAGCCGCTGGCCAAGAACTCGGTCATGAGCTACTACCGCCATGTCAAG
AACCACCGAGCCACCATCGAGAAGAAACTACTCAAGATGGGACAGACGCTCGAGCGCCATTGTCTGAAGCGCATCGATTGTGGAATGGTCAAGAAGGCGC
CTGCCTGCACGAAGGAAGACGTACGAATTATCATGGACGGACTGTACTATGATGCCGCCAGCCCCAAGGACTATCAAGATGCCGCGTTACTGGCGCTGGT
GTGGTACGCGTTTGGCCGAGCCTCGGACCTGGGGTTCGTGGTGAAGGGAAACCTGTCTGTGAGTGCGGCTGGCGTTGTGTTCGTCCGGCTCATCCGCGTG
AAGACTTCAGACGAGCAGGGCATCTCTCTCTTTCCCGACAAGAACAGCTTCATCACGTGCCCCCTGCATGCGATTGCGATGGCCCTGGTGATGCAGGACG
CTCCGTGCGCACAGCTGCTGGAT