Description :
From Genome Similarity Track
Location :
Scaffold_2:1111233- 1112618
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000783Similar to CTSL1: Cathepsin L1 (Fragments) (Gallus gallus)

Sequence
1385 bases(100 bases per row)
GCGGCGCGGCGACGATTCGAAACGATCACACCGATCACGGTCAGCACGATTGTCGCAATGGACACAACAACGGCAGCAGCGATCCAGACGCCTGGTGCAA
ATCCCAAAAACAACCTGTCACCGCCACCATCGACAACAGACTTTACGGCTCCGGCGGTGGCGCCGAGAGGAATGACTGGGAACACGTTCACGCCGCAGTT
GATCTTCGAGTCCATCTTGAGCTTCAGGAATCCCTTGTCGCCCCACTGCGGCGAGTACGAGTTCTTGAGGATCCAGTAATCCGTCGATCCATCGGTGCCG
TAGCCGACAAGCACGACGGCGTGGTCAATCTCCGACGAGTCCGTAAAATCGCCGCTGTTGGGGCACTCGTAGATACCGCCCTTGTAGTCCTTAAAGTTGC
TTCCGGAGTTGATGGCGACCGAGATTGGTTGTTGCTGCAGCGCAATCTTCAAAAGTTCTGTGGCATCCGTCGAGTTGTCGCACTTCTTACCCACAACTTG
CTCCCAGTTGTTAATGCTCGCGGCGGCCTTCGTTGAATCGTTCTCGCACGTCGCATTGGCCGACGACACCGATGGCGCCTTGGTGGTCGTCGTCTTGAAC
GGGTTCAGCGTCACAACATCCACTTCCTTGTACGGCATGTCCAGCTCCGTCATCAAACTGAGGTGCAGCGCCGCGGCGTCTTGGAACGCACCGTGAGTCA
TACCACCATCGCAGACATTATTCTGCGAACCCCACTTCATTTCTGGTTGCAGCCATGTCGCTCCCTTGGCACCGGACGCCGCCCAGCAGTACTCAAAGGT
CGCCGTCATCTCACGCTTACTGCAGTCGAGGAACTGTTGCGGCGAGAGTGCCTGTGGCGAGTTCCCAGAGTTCACTGCAACGGCAGTCTCGATAGCATCG
GTGGCCGCGAACGCCCAGCAACTACCGCATTTGTTTTGACTCTTGACCGACGTGCAAATGTTCCTCTTGAGCGGGTTGTCGGTCGAGCACCAGTTCAGCG
TCGACGGCAGCGTGACCGCCAATCGTCGAGACGCCTCCGGTTTCACTTGCATGGCCTCCTCGGCTTCTTCAAGGCGACGTCGCGTCTGCGCATGCACCTC
CTGACGCACAAACTGCTTGGCCGTGAGCTTGCGGTTCCCATCCAGGTACAGGTGACGGGCGTTCACGCCGATCTTGTACGTGAACGCCAGGCCTTCTTCC
GCCGCGTGCATCTGCACGGCTTCCAGGTACCGCATGTGCTCTTCGAGGCGCTGCTTCTCTTCGTCGCCGTCAATGCCTTCGCTTTCCATCATCTGGCGCA
CGATCTCGTCCGAGACGACAGGGGTGCCGTCGGCACCAGCCCAGAGGCATCGACTGCCCGCTGCGCACTGCAGCAGCGTCCCGAA