Description :
From Genome Similarity Track
Location :
scaffold_1470:1111- 4428
Transcript NameFunction/comments
Pl_100642conserved hypothetical protein
Pl_100643hypothetical protein TcasGA2_TC002224

Sequence
3317 bases(100 bases per row)
ACGAGACCGATGGGACTTCAGCAATGCTCTGTGCAAAATTTGTGACCAGCGCGGCCACACTACTAACTATCACGACCGTCACGTAGCCGAGCAACAGTAC
AAGCAGCCCACCAACCAACCCGCGGGCCACGCAGCGGTCACGATGAACTGAATGAAGGCGCGGGGTGTCGACAGACACCGTGTCTAAACCATTCGACCCC
GGTAAAACTATTGTGGAACCGATTATTGACTCCGGCGCCTCGTTTCACATGACTGGAATTCGAAAAGCGCTTCTGAATATCGCTCCTTGCGATGACCACA
CAATCCAAATGGCTGACGGGCATATCGTTGTGGGAACAGAAGCTGGTGACCTCAAGATCGCAGATGGACCTCATGGTATTGTACACAACGTGGTGTACGT
ACCATCCCTAGCGCAAACTCTCCTCTCGGTATCGGCGCTCACAGCAGAAGGATACAAGTGTGATTTTAGTGAAGATGGATGTACCGTGTACGGACCTGCT
ATCATTCGAAGTGCCATTTGTCATGGAGTGTACGTTAGTACCAAGACGACTGGAAGTGGTTTCTCTGCAACATCGCACACAGTTGATTTTCCAACAGTTG
TGAAGGACTCGCTCGAAGATTGGCATCGTCGATTAGGCCACTTGCATTATCAAGCAATTCTAGATATGGAACGTGATGGCCTTGTTCAAGGACTACGCAT
CAAAGGGCCAAAGACATTGCCCACGTACCCGTGTGAGGTGTGTGCACTTGGAAAAGGTCACAGCAGAGCAGCTCCTCGACGCAGCCTTCGAACACAGGCA
GAGAAAGATCGCATCTGCCACGCTGATCTTGCAGGCCCATTTCAGCGCAGTATCAACGGGCACCGCTACTACATGGCGGTGAAGTGGAAAAATTATACCC
ATGTATTCTTTATCAAGACGAAAAGTGAAGCGGTTGAAAAGTTTCGGCACTACATTAACCTTGTGAAGCGCCGCAATGGTGACGCCGATTTTTGTGTACT
TCGCACGGATAACGGTGGAGAATTCATTGATAAGGCTTTTGATGACTTGTGCGCCGCAGAAGGCATTGAACGACATCATTCTGAGCCCGATAAACACTAC
CAGAATGGGGTTGCTGAACGAACTAACCGCACGCTAGCAGATATGACACGGTGTTTGTTACTACAGGCAAATGTCCCTCACAACCTCTGGGAATATGCGG
TTCGGACTGCTGTTTACATGCGCAATCGCGTCGTTACGCGCAGCAACCCAGGCACTACGCCATACACCCGATACCATGGTAGTCGCCCAGATGTTAGTGA
TCTGCACTCATTTGGTGAGAACGTCGTTGTTTTACTGAAGCCAACACAGCGCAGCACAAAGTTTAAGTTTCGACCCACCGGGCAGCGTGGAATTTACGTA
GGACCTGATCACCAACGCAAAGGTCATTTTGTTTACATCCGGGAAGGTGGAGCTCGAATCGTTCACAGCTGCGATGTCACATTCATGGGCTTCTATCTTC
GGCCTCCACGACCATCAAGCGCTTTGGACCCCGTATCCACTTCACCGGTCATGCCTGACCGCTCTTCCGAAGTGAGACTTCCGTCTCCGAGCAGCTCGAC
GCGGGGAAGGGACTGCACAGAACCTCTACCGGAAACTGTGGAGACACAAAATGAAAATCCGAATCTCACTCAGCGCCGTCGCTCTGAGCGGATAGCTAAA
AAACGCCGGAGCTGCATTCTTAGTGCTAGGAGAAGTGATCCAGGAACCGATGACATTGAAAGAAGCCAGGATTTCCCCGCAGTGGCCGCTGTGGAAAAAG
GCTATTAAGGACGAGATCGAGGCGCTCCGTGCCAACGGGACTTTCACGGTTGTGACACCCCCGGCTGGCGCCCATGTTATCGGATCCACCATAAATTTCA
GGCTTAAGCGCCAGGCAAACGGCTCAATTGATCGGTTCCGAGCCCGGGTTTGCGCGCAAGGATTTGGCCAGATATACCTGCTCGACTATATCGAGACGTA
TGCCCCCGTTGTGACTCTAATCTCTATTCGTGTGTTTCTAGCTGAATGCAATCACAGAGCGTGGCACATTCGACAGGGAGATATCCCCACCGCCTATGTC
AAAGCAAGACTTCGGGAGGTCATTTACGTAAAGCAGCCAAGTGGCTTCGAAGAAGGAGAATCTGGGCAAGTATGGTTGCTTTGCAAAGCACTATATGGCC
TCAAGCAGTCTGGACGGGAATGGAACGCTGAACTCAATTCTTTCCTCCGAAGTGAAGGTTTTACTCCCCTGCGAGAAGACCCGTGTGTTTACAAGCACCC
TACGAAAGATTTGATCATACTCGTATACGTTGACGACATTCTGATAGGCTACGACAGCACTGAAGAGATGGATGAATTGATGTCAGCCCTTCACGAAAAG
TACGACATCAAGGACCTCGGAGAGCTTTCGTGGTTCCTTGGCATGCGTGTCACTCGCGATTTTAAACTAGGCACCATGTGCATTGATCAAGAGCAGTATG
TCACCGAGATTTGTCATCGATTTTCAATGGACGAGTGCAGAGTGGCGACAACGCCGATGGATCAAAATACTCTATTGTACAAGGCTGTTAGAGGAGAGGA
ACTTGCAGAACACGTCCCATACAGGCAGGCAGTCGGAGCCTTGTTGTACCTCAGCCGAGTTTCACGCCCAGACATTGCCTTCGCAGTTAATCAAGTGGCG
TCTCAGTGCAACAATCCAAGTGTTCGCCATTGGCAAGTATTAAAACGGATACTACGCTATGTATCAACTACTCGATCCATGGGGTTAGAATTCCGAAGCA
CCCCAGATGCTCCGCACCTGCAGTTGTTCACAGATGCGGATTGGGCAAATGACACAAGCGATAGAAAGTCGATTTCAGGTCAGTTATTGCGCGTGCACGG
CAGCCCAATTCATTGGTCCTGCAAGCGTCAGACCGTTGTGGCTAAATCATCGACCGCAGCAGAGTATATCGCTGCTGACATGGGCCTGGAAGATCTGAAG
TGGACGGCGATGTTAATTAGTTCGCTCACGGGCGTGAAGTTGACCGAAATACCCATGATGATCGACAACCTCTCGGCGATACAGAGGATCAAGAAGGAGA
AGATTTCAAACGCTCAGAAAAGTGTTGACATCGCTTTTCACTCCATTAAAGATGCGTACCGAGACGGCACTATCAAACTCCAGTATTGCCCAACCTCCGA
AATGCTTGCTGATGGCTTCACGAAAGCACTAGGAAAGACACTATTTTGCCATCTTCGAAGTGCGCTAGGACTCATCAAGCTGGCCTCAACAGCTGACTCG
CGGGGAAGTGTTGATGC