Description :
From Genome Similarity Track
Location :
Scaffold_4:111091- 112157
Transcript NameFunction/comments
Albla_Nc14006600Monovalent Cationx3aProton Antiporter1 (CPA1) Family putative

Sequence
1066 bases(100 bases per row)
TTAGGCTGCTACCACCTATAATACTCGAGGCTGGATTTAGTATGAAGAAAAGGGGTTTCTTTGCAAACTTTTCTACGATCTTATTACTGGCTGTCGTGGG
AACTCTTATAGCTACTTTTGTAACTGGAGGTGTGCTGCTGTGGTGTGGAAAGATGGGACTCGTGACCGAACTTACGGCTGCAGAAGCATACCTATACGGA
GCAATGATTTCAGCAGTGGATCCGGTGGCCACACTATCAGTGTTCAAGAAGAATGGAGCTCCATCAACACTGTTCAATTTGGTTTTTGGTGAGAGCGTAC
TGAACGACGGCGTAGGTACGTCATCCCTCGGTCTAGTGAAGGACTTGATCGCTAAATTCACGTCTGACCAGCCATTGTGGCATTCACTGTATTTCAAGAA
ATGATTCACGATGGCGTCACTGAAGTAACTTTGGATGTTGCGAGCATGGTGATCTTGAAGGTTATCGGCATTGGTTTGGGATCTGTTGGACTTGCTGCGA
TAGTCTGCTCGACTTCAGCGTTTTTATTGAAGCATGCAGACCCAATTCTGCATCACTATCCCTCATACGAGATATCTATCGTCCTCCTTTCGGCTTATCT
AAGCTATTTGGCGGCTGATCTTGCAGGATTAAGCGGGATTGTAGCTCTCTTTATTTCCGGTGTTTTAATGAGCCACTACCATTTGTACAATGTATCGCAA
GAGAGTGCGACTGCTCTGCGCCACTTGCTCTCTACAGCATCGTTCATGGCCGAAAACTTCATTTTTGTTTATCTTGGAATGACGAGTGTCGCTTATCTGG
AATACTTTAGTTGGGATTGGGCATTCATCTTCTTCAACTTGCTGGCCTGTCTTCTTGGAAGATTCCTGAATATATTCCCACTTTGCGCCTTGGCCAATTG
CAGGAGAACGAAGAAAATCCACATCAATTATATGATCGTGATTTGGTTTGCTGGTTTGCGTGGAGCTATTGCTTTAGCATTAGTACTGAATGTTTACTCG
CCCAACAAAAATAACGTCGCTGTCATGCAGAGCACCACATTGTTCACTGTTATGTTTACCACAGTG