Description :
From Genome Similarity Track
Location :
contig_187:11109- 16162
Transcript NameFunction/comments
g11985.t1hypothetical protein
g11986.t1hypothetical protein

Sequence
5053 bases(100 bases per row)
ACTGGTGAACTGGTATGCGATCGCGATTTTCCTGCCATGCATGCGTACGAGCGCGCCGTGAAGGAGTTCAAGCGAACCAAGATAGGGAAGGAACTGGAAG
GACGGATCGTGCTGTTTGAAGCGCTGGCATCGAAGTTGGATGAAATAGCAGTCGAGCACGGTGTCAATCTCGGCATCTCCTGGAGCAAGCACTCGTGGTC
GATGCAGCCAGACCTATCGTACCCAGACGTGTCGACTCATGCGTTCCGCTATGTGAAATCGCAGCGCAAAGGCATAAGGGGCTGCTCAAGAGGCAAATCG
AGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGACACGTTCGTACGGGATTTCAAGACCCGTGCCGCTCGTCTGAGCGACAGCTCAACACG
CAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGGAAGACCATGGACTTGAAACGACTGCTGAAGACGAAGATATTGCTAGCACTGAGGCA
ACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCGGAAGCGCAAACAAGCACATAAGGTAGCAGAGCTACCCGACACCTTCGGTGTCTATC
CCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAACACCTCCCGCAACGACACACCTCCCGCGACGACACCTCCCGCAACGACAACGCCTT
CCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACACCTCCCGCGACGGTCGAAAGCCTACAGTTCCACTTTCCGTGGCCGATGCACTGGCG
AAGATCAAAAAAGAATTCCCCAGTACGTTAAGATGACTGCGGAGGAGTTGGTGAATTTTCAGAATCTGCTGGTTAATGGACAGCGTGCACCATCGGAGGA
GGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAGAAGGGCAAGTTCGTCAACGTTACGAAGGACGTCTTCATGCGCATGGTGTCACTGGTA
TTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAGGAGTGGAGGTGAAGACCGTTCAAACTTACACTGGACGCCTGCGAGTGATACTGAAGC
GGGTGAACTAGCGCGTGAAGTTGAAGCTGCTAGTGTAGCAGGTAGCTGAATTAAGGGGCATGCTCTAGTCTATCTCTAAGTCTCAACAAGAAAGTCATAA
CCTGCGCGTGGTGTGTCGGATATATGTCTCTCAGTGAGCGAATGCGGAAGAGCGGCGAGGCTCTATTTGTCGGCATCGTCGCAACTACGTCCACCGACAG
CGAGTGCTCCACAGCCAGCCAATCCAGTCTCGCCAGCGACGCGTCTTTCTACAGCGCGGTCGGTGACGAGAGTGGGCTGGTCGGTGGCGCAGTGGACGGT
GGGCGGATCCACTAGGGGTGCGGTTACACACTGTGGATCCGCTCGCCCCCGTTTTGGCCCTTTCCGGACCGGAAATGGGGCCCGAAGAGCCTCCACGTGC
GGTGCCGCTGCTCGGCACCGGCGACGCTTCAGCGGCTGCAACTTCGGGCACGGGTCCGGGACCCGCAGCGCCCATTGCACCGCGACCCCTCACGCGCCTC
GAGGCCGCTGCCGGCCAAGAGACGCCCCGCCCCGCCTCCACGACCTCGCGTCGTTTCGGGATCCACCGGCGGATCCACCGTCCGCTGGCGACAGTGGACG
GTCCGCTGGTGCGGGCGGGAGGTCGGCGCACCCCTCCCCACTCGGCCCACTATCGGCCGAATGCTGGCCTCTCAGGCCGTACGTGTAGCGGGGCTACACA
TTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGT
AGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGA
GGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACT
GAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTT
GTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACA
CGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGT
AGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTG
TCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGAGGTCGACACTGCCATT
ACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAG
ATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGA
TCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTC
GTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAG
AAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCT
CTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACA
GCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGG
TGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAAC
CTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAA
GGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGC
TTCTCTTACAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGA
TCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGT
GGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTG
AACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTC
GAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGG
AAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGA
ATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGC
AAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGA
GTATTGGTCTCCAATACAAGAAGATGAGGCTGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGC
GAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCG
CGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAA
GGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGA
CAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCG
CGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACC
TCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTC