Description :
From Genome Similarity Track
Location :
Scaffold_34:111081- 115110
Transcript NameFunction/comments
Hyaar_Emoy2805002hypothetical protein

Sequence
4029 bases(100 bases per row)
CATGGCACGGGGGAATGCCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTGACACCTTTAGGAGGTAAAGCTGAACAGGGTT
TAGCTCCAAAGAGTTCCATGCCTACTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAGGCTTTGAAAAGCCACGGTCGG
TTTTAATTGATTCTGGGGCGTCTTGCAATTATTCTCGACGTCGTTCCCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTC
AATCACGGTTCGTTTACCGACTGGTCACTGTACCTAAAGTTCCTTTGAGCTTAGGCATAAAGGTTTTGGACTTTGATAGCATTGAACACTGTCTTGTCCT
TGATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGAGGTCAAAGACCTTAGGCGCTACGCAC
AACGTTCCTAGCGAAGCTTTGGGGATTCATGAACCCACCTCTGCTAGGAATCAGAAGCGCTATCGGCGCGAGCCTTTGACAGAAGATGTCAATGTACTGG
ACATTGGAATGTCTGAGTTAACTAACCCCAATGTTGAAGACATGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGATACGGCACGTACTCCGTTGAGTGT
TACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTAATTCCTTTGATGTGTGTGGGGTGGCACGT
GAAAATGCACCGAGTGCGGTCTGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATCAGCTCTCGTATAGAGCGTACTACTAGTAGTAGTAACCACG
GGGACACACTTGTCCCGACCCCAGAGGGGTGTAAAGTCTTATCGAAGAGAAGACCTGGACGCCAGGTGGCAACTGTTAAGCGCCAGGCGTCCGAGCAGTC
ACATAGTGAAAATAGTGATATACACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGAAATGTTAGCCTGGAAACCCTACCATCTTTGGATGCTCTTTGTG
AGCTAGAAGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCGAATTAGTGGTCATTAGACCCGATTTCGAGTTGAACTCGTC
CTTATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATCCT
TTGGTAAAGGGATTTCAAGATGTGATGTGTCACAACCCACCATCTGTCTTACCTCCCAAGAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTA
AATGCTGCGTAACACGGCAGTGGCCTTTACCTAAGGAAAATTGTGACGTCATTGATGATTTCTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGT
AAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGTCTAATGGTAAGTGGCGGATAGTGCACGCTTATAATAAGCTCAATGCTGCCACTACTTCGG
CTCAGACACCAATCCTCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCT
CATGCGATCAAGCGATATTCTGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATTCCCCGGCT
GCTTTTAATCATCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACGGTC
GATCTGATGTGGATAATATACACTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACAAATAAATTGTATGCAAATGCATCTTTGATGCAGGAGAGAT
TCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCTTTCGAGCGGACCCCGCTAAGGTAAGGGTCATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGAT
CTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGCGCGAATTACGCAAATATGGCTCGGCCATTGTCCAATCTCCCTAAGAAGGGTGTGG
ATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAATCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCCTT
CAGTGTCGTCGGTGACGCATCTGACTTTGCCATAGGTAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTGATTGCATTCGAATCTCGACAG
CTCGAAGCTGCTGAAAAGAAATATACAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCCAAGC
CATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTAGTTGGCTTTCATTCTTTGCCGAATA
TAACTTAAAGTGAAGTATAAGCCAGGAACGCAAAATGCTTTGGCTGATGCGCTATCGCGCCGAACTGACTATGAGCTTGCTCACGTCACTACGCTGTCAT
CGTCAGTCACTGACTAAATCCGCGCGGCTTATGCCAATGATGAACTATGTTTAGCTTTGCTACGTGCTCTTCGAGCGAGGAGTTTAAAGACTCGGACATA
AAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTTAGGATAACCCTCGTATCGCTG
TCCCTCATGATGAGGAGTTGAAATATCGAGTCCTTCATGAAGCACGTCATACCGCTTTAATTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAG
TCAGGCTTATTGGTGGTCCAAACCATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAAGGTGTCAACGGGTGAAACCCTCAGCACAGGCGGCGGCA
CCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTTGCATTG
TGGTCTTTGTTGACTGATTGAGCAAGATGGCTCATCTAGCGACAGTGCCGGACTCTATTGATGCCGAAGGTACAGCGAAGCTATTTATTGACCGTGGGTT
TCGACAACATGGCTTGCCAGTAGCAATTATCTCTGGTAGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGCCCATCTTCAAGGTGCTCGGCACCCGTTTG
GACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGATCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTA
AGCGTTGGAGCTCCATGTTCCCTGTTGTTGAGTTTGTTGAACAACGCTGTTCATGCCTCTACAGGATACACTCCGTTCTACGTAAACGGTCTCACCCACC
CTCGCGTTACGTTAACGCTACCACTATGTGGTTCAGGGATTGGTGGGGGAGAGATTGCCGATCGGCTTGCTGATATCAGCCCTGCGACTGTTCAAAAACA
GGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAATACATGTGCGTGACGCAATGGCTGAAAGCCAAGACCTACAAAAACAACAAGCAGATGCTAAA
AGCAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCTAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAGACAAAGTT
GCGTCCGCGCTTCATTGGACCATTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACATCCTGTGTTCTAC
ATTGGCTTGCTTAAGCAGTATCGGGATTC