Description :
From Genome Similarity Track
Location :
Scaffold_38:1110618- 1114759
Transcript NameFunction/comments
Phyin_T30-4PITG_15139Phospholipid-transporting ATPase%2C putative

Sequence
4141 bases(100 bases per row)
GGTGGAGTTGCGCATGGCAGTCGAGATGGCGTCCGAACGCGGCAACGAGTTTGAGGCGATATACGACTCGGCTAACGTCGTTTCCTCGTCGCAACTGAAG
GCAAATCCCGTGTTGCGGCGGCCTGTCGTCCCGCGAAACATCTTGGTCGGGACCCGCTCCCACGTCGCGTCCTCCGAGATGGACTCGCTAAACACACTAG
CCGAGTAGCTATCGGTAACACCCGAACTAGTCGACTGAGGCGCCGATGTGCCGACGTTTGACGCGCTCTTCTTCGGCTGCTGTTCGTACAGTGTCGCCGC
GAAGCTTTGCGGGTGTTGCGCCTTGAGAATCTCCGCGTCGGAGTGGCCAAAGTCGCTCAGATACCCGGTGGTGTGGACATCGTCCAATGACATGGACAGG
GTCTGTTCCTCCATGTGGTTAATTGTCAGACGTCGCTGATATTTGCGTTGCGAGCCTCCACCCATCGATTCTTGCAACAGTTGCGCCAGATCCGGATGGA
ATGTCCGTTGGTACAAATTGTACGCAACATGTCGTCCGAGTGCCAGCGAGCAGCCCATGATGAGCACCAGAAAGTAGCCCCACGTCTTAGCTGTGGGGGC
GAAGGCACCGAACTCGTCGTATCCGATCTTAAATGTGGCAAAGTAGGGCGTCTCTGTACCTATCGCAGCGAAGCCGAACCACGACATAACACTGCCGAAC
CAGAGCGAGAACGACAGCAGCGTCCACCGGTCGGCGATCATCCAGATCTTGATGTTCACAATGAGAACCGTCAGCGAGAACGCGACCATCCCGAACTCCA
CACGCGACTCGCTGCCTGCCGATTTCTCCGATGCGTTGAAGCCGTACGACATGACCACAAATATGATCAAAGACTCGTAGAATGCAGCGGCGATCCAGCG
GCAGAACGTGTACATGTTGAAGAAGAAGCGGTCCGGCCCACGACGGTACAAGTCTGGGTACTCGATACTGAACGGGGCAGGTAGATCCTTGTCCAGAACA
CCCACCACCACGATTGGTAGGCCCGTGAAGGCGACGTTGTATAGCTGGACGCCGATCTCCCAGTACATTTTCGAGCCTGACGCTCCCGAGAGATACCCGT
ACCAGTATTGCGCCAGTACCAGTGTAATGTTCTTGTAGAACATGTAGAGCACCAGTTTGGAGATACGAATGTAGTTCCAACGTCCGTGAACCAACAACAA
GCGTTCCAAGAAGCGGAACTGGGCGATAGCGTAATCACTCGAGTTCACAGCCTGCATTCCTTCCTGTCCAGAGATGCCTACGCCCACATGAGCAGCTTGG
ATCATCGCCACGTCATTGGCGCCGTCACCAATTGCCAGAGTTCGGACCGTCGTGATATTATCTCGCACCAGCTTGACCATCTCTGCCTTCTGCGCAGGAG
ACACTCGGTTGCAGATCACTGCACGACACAGCTTGGCAAACGACAGCAAGTGCGGTGCCGTTCCTGGTCGCAGAGCCATCTCCAGCGCTTCGCCGTCGAT
AACCAGCGAGATTTCCTTCTCACTGCCGCCTGCCATGCCCTTGGCACCGTCCAGGAACTCCCTGGCTGCAGCATTCAGCTTGGCACGGATCGCTGCCTCA
TCTGGACACGTTGTGGCGTTCACTATGACCTGCTGGATCGAGTTGTCGAGCAGAGAACAGGCGTACGAGATGTTGATCGCCGTCTCTTCCTTGTCGCCTG
TGAGCATCCACACTTTGATCCCTGCTCGCGTCAAGTTGGCCAGACACTGCGGCACTCCGTCTTGGAGCTTGTCTTCGATAGCTGTGGCGCCGATGAGCTC
TAAACCCTCCTCAATCTCCTCCATCAGAGCGTCGATAGCGTTCGGTTTGCCGTCTTTGCGTCGGTCGATCTCTGCCACGTTGCCCTGAGCGTCGTCGAAG
CGCATCTTCCACTGCTGGAACCAGCGCTCGTCCAGCTTCTTGACTGCAAGCGCCAATGTCCGCAAGCCGTCGTCTGCGTATTTCTCCATGTGGTCTCGCG
TGATGTTCTTGAGCTTGAGCATCGCCGGGTCGTCTTTCAAGCGCTGGTAGATCATCATGTCGGCCCCTTTCGTGTACAGCAGCAGCTCTCCGCTTGGTTT
ACGCACCACGACAGACATTCGCTTACGCGTACTGTTAAACTCGAGCACATCCAGCACTTCATAGGTCACGCGTTGGCCCAGCACGTCCACCAGCGCTGTC
CCCACACGGCGACTCTCGAACTTGAACCCTGCAAAGGCAGCTCCAGCCACGAGAGCCTGTTCGTCAGGAGACGACGCTGACAGGCGCACTTCGCCCGACT
CGAGCTTCTCTGGGATGACCGTGTGGCACACTGCGAGATGCTCAAAGAACTGCATTATCTTCTCCTTCTGCTCTTCGCCCGCACTGCCTTTCATGCTGTC
GAACAGAGATTTGTCCACGAAATTCACGAACGGAATACTCTTGACACTCGGGTCCAGTTTGGGCTCGGGAGGGATCGGCTTCCCGGCTCGAACGAGTGCA
GCGCGTCCGATTTCTGTGATACCGGAGCCGTACGAGGTGCCGTTGATGGAACACTTGCGGAACTCCATGACGTTGCACGTCAACGTGCCGGTTTTGTCAC
TGAAAACGTACGAGATCTGGCCCAACTCTTCGTTCAGCTCCATCGTGCGTACGATAGCTGGTGTGTCCGTTTCCGCGTGGTACATTTCGAGGTCCCACGA
CATGAAGCGCGACTGCAGGAACTTGACACTTGTCATGGACACATAGAGCGAGATGGGGATCACCTGATATAACAGCAAGAAATAGTAGAACAGCATCTGG
ATAAACGCCACGAGGCGCGTGCGGTTTCTCTCCGATTCGGAGAGCTGGATGTACCAGGCGTTGCGCACAATGTCGTACTGCCACGTGATGTAACAAGTTG
CCGCCATGGCGCAGGCAACAAACAGCCCCAAGCACAAAATGACGATCATGCGGTTGATATTCAGCATCAAGTCGCTCCACTTGGACGGCGCGGCGCTGGC
ACTCTGCATGATCTTGGTATCGTTACCGGTATTGAGCACGAGGCAGAAGACCCAGTCCGTGTTACGTAAGTTACAGCCTCGTAACAAGACGTTCTTAACT
GATAGCGGCATCACTTCCACGCCGCAGCCGTCGCCCACGGTGACTTCCACTTTGCCTGCGAACTTGTTGATGTGCGGGTTGGGCTGCTCGCACTTGATGA
CGCCGCGAAGAAGCGCCAGTTCCGCGGCGTTCGAGAGCGAGCTCATGGTCGCGGCCACCGCCTGACGCAGCTTGAGGTTCGTCTCGCCGTCCAAACTTTT
GGTCTCGACGTAGCAAATCCCGCTGGGCGGCTCGCCCACGGGCTCCGCGACGGCGAGCACCAGCACGTCGGCCGGGATCACTTCTCGGTTGCGGATCTGT
AAAAAGTCCCCGACTTTAATGTCCGCCCACTTCTTATCCACGACCTGTCCGTCCTGAATCACGTGGCATGTCGCGGAGTTGGCCTCGTTGTCCGATTGGT
GACGTCGTAAATCCTCCATCACAGCGAACACGGCGTCGATCGAGATAACGAAGAACAAGACCGGCGCGTTGGTCGGGTAGCCGTACGTGTTACTGATACT
GGGGATACTCTGCAGCACGCAGACCATTAGGAAGAAGAAGTTGGCCACCTTACTGAAGCTTTCTTTCAGAAACTTGGGCAGGAACGTGGCCACGTTGTAC
TTGGACGTCACTACGACGTTCGAGCACTTGTCGAATACAGCGTTGCCCGGGGCATAGTTAAAATAGACTTCTCGTAAGGTTTCGTCCGGGCCTGGCGCTC
CTGCTGCTGCTCCTGGTTGACCACTTCCCGACGTAGACGCGGGAGTGTGCTGTGCTGCATAGTCCACGAGTTCGTCCTCGTCCAGAAGCTGCTCTTTTGT
CTGTTTGCTCTTACGTCGTATCTGTCTAGGAGACTGGAGCAGTGCTGGACTGCCCAAGGTGTTGTAACCGCTGGTACTTGAGCCTAAAGCGTTGTCGCTT
TGGTCCGAGAGCGCGGAATCGTCTCGAGCGGGCGCGACGCTGGAACACAGCGCCACCTGGTCCTCCACCCGCGAGCCGCGAAAGATGCGCGACGTGCTGC
GCTTGGCAGCCATGAACGCGTCCTGTTCCTGAGGCTATAAA