Description :
From Genome Similarity Track
Location :
Scaffold_10:111029- 113715
Transcript NameFunction/comments
Hyaar_Emoy2801916hypothetical protein

Sequence
2686 bases(100 bases per row)
TACGGCTTAAGCAATCCCACGTAAAACACGGGATGTGTGCGCAATTTGCGTGGAAGGTTGAGCGTATACGCAAGTCCCTTCTTAGCAACGACCGTGAATG
GTCCAATGAAGCGCGGACGCAACTTTGTCTTGAAGACAGCGGACACTACATTTGTAGGTAGGTTTTTAGCATTGAGTAATACTTGGTCTCCGACCTGATA
ACGTTCAATACAACCTCTGCTTTTAGCATCTGCTTGTTGTTTTTGTTGATCTTGGCTTTCGGCCATTGCGTCACGCACATGTCTTAAGACATTTAATCGC
GTTGCAAGAAACTCGCCTACGTGTTTTTGAACAGTAGCAGGGCTGATATCAGCAAGCCGGTCGGCAACCTCTCCCCACACCAAGCCCTGAACCACATAGC
GGTAGCGTTAACGGAACTCGAGGGTGGGTGAGACCGTTTACGTAGAACGGAGTATAGCCTGTCGGGGCATGAACAGCGTTGTTCAACGCAAATTCAACAA
CAGGGAGCATGGAGCTCCAACGCATAGGCGTATCAGCGCAAACACTGTGTAAAATGTCATTAATGACGCGATTCACACGCTCAGTTTGACCATCGGTCTG
TGGATGATCTGCTGTGGACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCCAAAACTTCCCAGTGAAGCGGGAATCTCTATCAGAGACAATT
GCCACTGGCAAACCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGATGTTCCTTCGGCATCAATAGAGTCCGGCACTGCCGCTAGATGAGCCATCT
TGCTCAATCGGTCGACAAAGACCACAATGCCAGTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATACTCATGGACTCCCAACACCCAGT
GGGTACAGGCAGACTAGCCAGCGGCGCCGCCGCATGTGCTGAGGGTTTCACCCGTTAATATGTTTCACACGTACGCACATAGGTGCTCGCCCACTTGTAT
AGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGGGGATTTGAT
ACGTCAACTCCTCATCATGAGGGACAGCGATACGAGGGTTATCCTCAATATCTGTGCGATAGCACAACAGGCCATTATCGATAGAATATTGATGTAGCCT
CGCACGTAAACGTGCCGAAAATTCTATGTCCGAGTCTTTAAACTTCTCGCTCCCAAGAGCACGTAGCAAAGATACACATTGTTCATCCTTGGCATAAGCC
GCACGAATTAAGTCAGTGACTGAAGATGACAGTGTAGTGACGTGAGCAAGCTCATAGTCAGGTCGGCAAGATAGCGCATCAGCCGAAGCATTTTGCTTTC
CTGGATTATAATTCACTTCGAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGCCATTCTCTGATATAGATGCGGCAACTGTATCGCAGTGCGCAATGA
TGCATGATCTGTATAGATCACAAATGGCTTTGAGCCAATCAGATGTACTCTGACTTGGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACT
GGATAGTTCTTTTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCTATGACGCGTTCGCGTCCATCGACATCTGTTTGTAACAGAGCACTGCCTATGGCAA
AGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCAGGATCGAGCAAAGCCAGTATTGGCGCATGAAGGAGACTTTCCTTAACTGATCGAAAAGCCTC
ATGTTCGGTGTCACCCCAACACCAATCCACATCCTTCTTAAGGAGATTGGATAATGGCCGAGCCATATCTGCATAATTCTCACTGTAGTTATGCAAGTAA
TTGGCAAGGCCAAGCCACTTACGTAGATCTTTTTGGTTCTTTGGAACCGGCCAATCGACTATGGCCCTTATCTGGGCGGGGTCCGCTCGAAGGCCTCGCT
TCCCAATGAAGCACTCCAGAAAGGGAATCTCTTCTGCACCAAAGATGCACTTAGATGCAATTGCATACAATTTATTCGTGCACATGCACTCGAGCACAGC
TCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGTTCGTTGCACGACTATGGACAAATATGTCATCAAAGTACGTTTGTGCATAGCCTCGATGA
GGTCTGAATAGTTGCGTCACCAGACGATTAAAAGTAGCCGGGGAATTTGACAGCCCTTGTGGCATACGAGCCACTCTCAGAGCATACCGCTCGGGGTACT
AACCGCTGTTAGCGGAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCATTGTACAATGTACATCCCATCATACTGTTC
TGAAGAACATCCTTCCTGGGGATTGGTGTCTGAGCCGGGATAGTGGCAGCATTAAGCTTATTATAAGCGTGCACTACGCCACTTACCATCAGGCTTTTTT
GACACAAAATGTAGGTGTGGAATGGGGAGACTTACTCTCCCGCACCATTCCCGCCGCATGCTTAGCACGAAAGAAATCATCAATGACGTCACACTGTTCC
TTAGTTAAAGGCCACTGCCGTGGTACGCAGTATTTAGTTCCTGGAACTAGGTCAATTTCATGATGTACACCTCTATCGGGAGGTAA