Description :
From Genome Similarity Track
Location :
Scaffold_13:111009- 112153
Transcript NameFunction/comments
Aphas_H257_05680Hypothetical protein

Sequence
1144 bases(100 bases per row)
TCGATAGATTTAGCGAAACAGCTCCAAAGTTGGGTAAAAACACAAAACTAGAGCCGGTCTGTCTGTACCTCCAAACACCAACGTCGAGGTGGAGTCGGTG
GCCACGACGTCGGCCGCCAACGTCACGGGGGCGCCGGCTTCGTCAGACGCGTCGAGTTGCGCCTTGAGGCTGAGCACGTTCTGGAGCAACGACTCGATGG
ACACGCCGCCGCCGCGGACCACGAGCTTGGCTTGGGTGAATCCGTCGAGGTTCGTGTCGATGTTGTACGCGAACGCCGACTCGTCCTTGTCCGTGGACGA
CTTCCACACGACCAAGATAGGGCGCGGCTGCAAATGAGCATGTCAAGGTGACGACGTTTTGGTCCATGATGATGTTACCGTGTGCGGGTCTTTGAGGGTC
GGAACCTTGGTGAGGAGGTTCGCCAAGGCATGGGCAACGCGAGGCGTGTCCGACACCACGCGGATCTACAAGTGGTCAACATGGAAGTCTACTCGAGTGC
TAGCGACGTACGGGCGTGCGAAGGGCGGCATGTGCGCCGACGGCACCGTCCGAAATGTACAAGTCCGCAGAGTGCGACAGCTGCTTGGTCACGTCGTTCC
TGATCGCGACATGAGAATGCTGCTGATGCCACGTCAAGGAACATACCAGAGGTCCAGGAAAGGTCCCGCAGGCGAGTTGGTCGCGGTGGCAGCAGGCGCA
GCAGCATTGGCCACGGGCGCGGCGACAGCGGCGGCGGCCGCCAACCGGTCCAACGCACGGTTGCGGTAGCAGTTGTGCAGCGGGGTGATGTCGTCGTCAC
CGAGACTCCAGTTGACCTCGAAGTTGTTGGCTTCCGTTTCTTCCGGAAACGAGCCGATGAAGTGGCGCGGGCCCTTGACGTCGGGTTCCAACTCGGACGC
AAACGACGGAGTCGGCACAGCAGTGCTGCTCATGGCACGCACCACAGAGACCTATGGATCCAACCAACTTGTCACCATGACCTATATGCGTGGAGATAGC
TCATGGGACGTACGCGAACAGAGCGGGAAGCGATAGCGACGGCTGCGCGGCGAACGACGGCGGCAGCTTGCATCTTGTAAAAAATGTCTGGCCGGCAACC
ATCGTGGGGGTCATGTATCCGGCACGACGTCAATGTCCGGATAA