Description :
From Genome Similarity Track
Location :
Scaffold_1042:1110- 8909
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1042-fgenesh-gene-0.0Callose synthase

Sequence
7799 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNGGTCTTGGAGTCCTGCTTTCTCCTTCTCGCTCAGAAGGTGTGTTGGGCTTGAAATGGATGATCCAGGCATCAAGGTCAACG
CGGTTCAAAGCGCCGATCGGCCTTTGGAGTCCCAAGAGCTCTGTAGACGCAAGAGCTCTGCAGTAGAAGAGAGTCAAGCAGCACATCGGTGTCTAGCTCG
ATTGCTCGCGTGTCAGCATTACTGAGTCCGATTGTTGTATCCAGCACGCAGTAAACACTTCGTAGATAAGCTCTAATCTCACCGGCCTTCTAATGTGCCT
TCGTCTTCTAATAATTTTCTCGCCTTCTAATTTCAAATCTCTCTTCGTGGTGCTGCCGGCCTGAGCTGGTGCCACGAATACTTTGAGCGCGTTGAAAGAG
CCTCAGTCAGTTGCCTCGACATCGGACTCTCGAACTCCACTCGCCTATCATGCCCATGGCCACTGAATGTTGCTCCTCCCCAGACTGCTCCTCCCACACA
CTTCGCGTTCGTGTCCAACAAACAAGGACATAAGGACACATGGCTGCATTTGCGCAAAAGACTGGAGACTGGCGAGATGGAGAATGAGCACGAGCATCTG
CTGCTCAAGTCTCGCGGTCCAGCGAAATCCGCACCGTGAGACAATCAACCAGACGCAATAGAGCTCATCAAAATTTTGGATCCACTTGTGGGCGAGCGAC
GCGAATTTTTGTTTTCTGCCGCCAATTGCGCTGGATACTTTCATACATTTTCCAAGTTTTCTTTCCGTCGCTGGATATTTGTTTGTTTTTCTTTACAAAT
CTGGCTAATTCTGCTTGGGCTAGTTTTTCTTCTCGTCTCCAAACAGCCTGTTGCCGGATGAGAGCAAACAATAACGACCGCACGAAAAGCAACAACTGAC
GTTTGTTTTGGTCGAAAGGTCTCGTCTAGCTCTTTTTAGCCCACACTGGCACTTTGTGTGTATTATTATTGGGGATATTCATGGCATTTGCTGGCAAATG
ACAGGCAAGAAGCAGACTTGTGCAGCTCATTCGCCATTCGCCATGATGGCAGACACGCTCTTGATAGCTGCCGAGAGAACTCTCAGCGGAACGAAAAGAA
CACATGGACTGGCTCGGATATTCGATACGCAGTATCTGCCGCCAGTAATTGTCGCCTGATTTATATCGAATTGAATAGGACTTCTATTTACAGAGGCTTC
TTAACTAGAACTTTCCCGACACTTCAATAGTGTATCTAAACGGTTGTGAGAGGGTATCGAGTATGCTCTCACCAATACCCACCCTATTTACTGCTGATGG
AAAATAGAGGCTGCCTATTCTGTCGCCCAAATCCATTCCTCTCCCACTCTCTCCTCAAGCAGCAACCAAACAAACAAACAAAAGAAACAAGCAAGTTCGC
AAGCCAACAACCGCGCTCAGTTTCCATCTCTTGCGCTTCGAGCCCAAGACGACGAGCCACAAGCTACACGCGCCTACACGCGACCCCTCCGAGGGACGGA
GGAAACGGACGACAGCCTTCTCCGTCGGGACCACCGACCTTAGCTTTCTATCGATCGCTGCCCAGCACAAGGCTCGCAGGTCGCAACAACAGCTTGCGCT
TGTGCGTGTGGTAACGCAAGATCCGCGCAAGCATGGAGCAGTTCAATCCGGGCGCGAGCGAGCTGCGCCGGCGCGCGAGCTCCAACTACTTTGAGCTGGA
TGCGGACCGGCGCCGCAACAAGTCCGAGCGCACGGAGCGCTTCAGCACGCGCCTGACGTCGCTGGACGTGTCGCAGGCGCCGCTCAGCGCCAAGTCCCTC
GGTGGCGACAAGGCCGACGACGAGGAGGCGTCCATCGACGCCTGCGCCGAGCTGCTGCGCGCCAAGTTCGGCTTCCAGGAGGGCTCCGTGGCCAACCAGC
GCGAGCACGTGCTGCTGCTGCTGGCCAACGGCAAGGCCCGCGCACGCCCCTCGGACGCGCCGGACGCGCACATCGTGGAGCTCCACAAGAAGCTCTTCAG
CAACTACCGCGACTGGTGCAAGTTCCTAAGTACGCAGCCGGTCAGCTTCCGTGGACCAGGCGTCGGCGCCGGCCCGCTCAAGCACGCGCTGCACATGGAC
CTGATGCTGTACTTCCTCATCTGGGGCGAGGCCGCCAACCTGCGCCACATGCCCGAGTGCCTCTGCTACCTGTACCACCAGATGCTCACGCTCGTGAACG
CTGACCCGCACGCGCAGGACCGCAAACCCGAGGGCTGGTACCTGGACGCCGTCGTGCGACCGATCTGGTCCGAGTGCAGCAACATGCAGCGCCGCAACAA
CATCAAGAAGCCGCTCGAGCACGTCCAGATCCGCAACTACGACGACGTGAACGAGTACTTTTGGAAGACCCACTGCCTGAGCATCGACGTGACGCAGGTC
GGCCGCGAGCTGTCGCAGAACCACGGCAAGACGTTCTACGAGCACCGCTCCATCTTCACCCTCGTGCTTAACTACTACCGCATCTTCCAGTTCAACCTCA
TGTTCATGGTGCTGCTCACGGTGCTCGCGTTCGCGGTCACGATCTCGCCCGACGGCGGCAAGGGCGGCTTTGTCCAGTTCGGCAAGATCGGCCAAGTCGT
CCAGCCCTACACCACGCGCGACCTCAAGCTCGCGGTCGTGGCCATCCCGTTCGCGCACGCCGTGCTCGCCGTGCTCAAGTGCGTGCTCGAGGCCTGCCAC
GGCTGGCACCTGCTGGTCGCCAAGGAGAAGTCGGCGTCGTCCTCGCGCTCCATGACCTACGGCTCGGCGCTCGTGGCGCGCATGATCTGGAACGGCGGTT
TCGCTGTGCTCTTCAGCTTCATGATCTTCGTGCCGCTCAACGAGGTGCGCGACACGGCGCTGCTGGACATGTTCTGGCCCATCGCCATCGGCTTTATCGT
CCCAGGCATCCTCGTGCTGCTCGTGCAGGCCTTCTCGCCGCAGCTCATCTCGGGCACGTTCGCGGCCAAGTTTGTGCGCGAGGGCGAGAGCTGCTACGTG
GGACGCAACCTATCGCCGCCCATGGCCTACAAGGTCAAGTACATCTCGTTCTGGATTGTGCTCTGGATTGTCAAGGCCATGGTTTCGTACTTCATCCTCG
TGCGACCACTCATGCTGCCGTCGCTCGCGATCTACACGATGAAACTCGACTACCAGAGCTCGCTTGTGTCGTTCCACAACATGGGTGTCATCCTCTCGCT
CTGGCTGCCCGTGGTCTTCATCTTCAACTACGACACGCAGATTTACTTTACAATCTTCCAGGCGCTCATGGGCGCGTTCAAGGGCGTGCTCATGAAAACG
GGCGAGATCCGCGGCGTCAAGGAGATGTCCAAGGCCTTCCGCGTGGCTCCGCAGCTCTTCGACCAGAAGGTCGTGACTACGCTCGCGCGCGCCAGCGACG
CGTCGGCGAACGGCAACGACTCGTCCCGTCCCAGCGCGCTCGCCGCGGCCTACGAGTCGCAGATGATGCTGCGCTTCGTCGTGGTCTGGAACGAGATCGT
CAACTCGTTCCGCGAGGGCGACCTGCTGGACGACAAGGAGGCCGCGATCCTCCAGTACGACATCCGCAGCAACGGTGAGGTCTTCGAGCCCGTCTTCCTC
TCGGCTGGTAAGCTCGGCGAGGCTATGAACCTTACGATCAAGACCGCCAAGGAGGGCAAGGGCGAGTCCCAGCTGCGCGTCGCGCTCGTCGAGAGTGACT
GCCTCTCGGCGATCCGCAGCTTCTACACGGCGAGCTTCTACGTACTCACGTCGCTCTTCGGCAACGACGACGCGGACGTGCTCGAGGGCTTCCGCATGAT
CGAGGACATCTCGACGGCCGGTGGCTTCATGAAGTCGTTTAACGTGCGCGAGCTCGTGCGCCTCCGCGCCGCGATCGTGGACCTGCTCGAGGAGATCCTG
GAGCTGCCAGACCCCGAGGTGCAGTCGCAACACATGCCCGGCGCGCGTGTGCACACCATGGGCGTCGTCCGCAACTTTGTGAACAAAATGGAGGTGTTTC
TCACCACGCTACAGGCGTTCTGCGTCGACCCGGCGCTGCAGCGCAAGTTTGGCAACTCCAAGTTCTGCTCCAGCTCGAACGGCTACCTCTTTGCGTCGCG
CGGCCTCGTGAACCTCTTCTGCAACGACAGCTCCATGGGCGCGGCCACGCGTGCGTGTCTGCTGCTGTCTCTGGAACGCGCCGAGGCCATGCCACGCTGC
ACGGAGGCGCAGCGTCGTCTGGGCTTCTTCATGAAGTCGCTGGTCATGGACATCCCGCAGCTCCAGTCGATCAAGGAGATGCGGTCGTTCTCAGTCGTCA
CGCCGTTCTATGCTGAGACCGTGCTCTTCTCGCTCGAGGACCTGAACAACCCGCTGGTGAACCACCCGATCTTCGAGAAGGTCGAGGAGGACGGCAAGAA
CCTGACGATCCTTAAGTACCTGACGAAGATCCACGAAGAAGAGTGGCTCAACTTCCTCGAACGCATGGATGTGAGCTCCCCGGAGGAGGCTCAGAAGCAG
TTCCCGCTCGACATCCGTCTCTGGGCGTCGTACCGCGGCCAGACGCTTGCGCGCACGGTCCAGGGCATGATGATGTACGAAGACGCGATCAAGATCCTCC
ACTGGCTGGAGATTGGTTCGAGCCCCGGCAAGAGCGCCGAGCAGAAGCAGACCCAGCTCCAGGACATGGTGCGCCTCAAGTTCTCGTACATCTGCGCGTG
CCAGGTCTACGGCAAGCACCGCGCCGAGGGCAAGCAGCAGGCCGACGACATTGACTACCTCCTGCAGGAGTACCCGAATCTGCGCGTGGCGTACGTGAAC
ACGATCAACCACCCAAACGGCGAGAAGTCGTTCGAGTCGGTGCTTATCAAGAGTGAGAACGGCGAGATCTGCGAGGTGTACAGCTACAAGCTCCCAGGCG
ACCCGGTCCTCGGCGAGGGCAAGCCCGAGAACCAGAACAATGCGATGCAGTTCACGCGCGGCGAGTTCGTGCAGACGATCGACATGAACCAGCAACACTA
CTTTGAGGAGTGTCTCAAGATGCCGCAGATGCTGCGCACGGCCGACCTGCATCCGTCCAAGAAGCCCGTGTCGATCATCGGCATGCGCGAGCACATCTTC
ACGGGCAACGCATCGTCGCTGGCCAAGTTCAAGACGTGGCAGGAACTCGTGTTCGTGACGCTCTCGCAGCGCGTGCTGGCCGACCCGCTGTACGTACGCA
TGCACTACGGTCACCCGGATGTGTTCGACAAGGTCATTGCTCTCACGCGTGGCGGTGTGTCCAAGGCGAGCAAGGGCATCAATCTGTCGGAGGACGTCTT
TGCCGGTTTCAACTCGACGCTGCGCGGCGGCGTCGTCACGCACGTCGAGTTTATGCAGTGCGGCAAGGGCCGCGATGTGGCGCTCTCGCAGATCTCGATG
TTTGAAGGCAAGCTCGCGAACGGCGCCGGCGAGACCTCGTTGGCGCGCGAGGCGCATCGCATGGGCCAATTCCTCGATTTTTTCCGCCTCAACTCGATGT
ACTACTCGCACACGGGCTTCTACTTTGCCACGTGGATGACGATCGTGACCACGTTTGTGTACATGTACAGCAAAGTGTACATGGCGCTCGCGGGCGTGCA
GACGCAGGTGATCTACAAGATGGAGTCCCAGGACATTATCAACTTGAACAACCAGTTCAAGTTTGTCGACCGCGCCTACCTCGACGTGGACTCAGTCATC
AACACGCAATACTACATTCAGGCTGGGCTCTTCCTGTCGCTACCGCTCATCGCCGTGTACTTTGGCGAGATGGGCATCCGTCGCGGCCTCGTGCAGCTCA
TTGAGATGATCATCACGGGCGGTCCGGCGTTCTTCATCTTCCAGGTCGGCACGACGATGCACTACTTTGACAACAACCTGCTCCACGGCGAGGCGCAGTA
CAAGGCCACGGGACGCGGGTTCAAGATCACGCGCGAGACCTTCGTGCTGCTCTACAAGGCGTACGCGAACAGCCACTACCGCAAGGCGTTTGAGCTCGTC
GGCCTCTGTCTCGTGTACCTCACGTTTGGCTCGTTCAACATTTGTAAACGCGACGGACCTGTGACCGAGAGCCTGGCGAGCGACTTCTGTCAGACCTCGC
AGGGCTTTGGCGTGCAGACGTTTGCGATCTGGACCATTTCGGTGCTCTGGCTCATGTCGCCGTACATTTTCAACACAGACGGACTCGACTGGGAGAAGAC
CAAGGCCGACATCAAGGCCTGGACGGTGTGGATGTACGCGGACGAGAATTTCAAAGACGAGGACCTGCCCATGTGCGGCGGTTGGATCAGCTGGTGGAAG
GGCGAGCTTAGCTTGTACCACAACTCGCAGCCAATCGCGCGCTTCACGGTGATCCTGCGCGAGAGCCGCCACTTCCTACTCATGTGGTACGTCGTCACGC
TCAAGTGGAACATCACTACCTTCGCGATCGTGCTGGGCGCCGTGGTGGCGACCGTGTTGGTAATGGGCATCATTGGCGCTGCTGGAACGACCATGAAGAG
CGTGTCGTCCCCCGTGCGCGCCGGTCTGTACCTCGCGTGTTTGACTGCGTGCCTGGTCGCGTACTTTGTCGTGGCGAGCGTGGTGCTGAACGCGACGCTG
CAGTCGTCGCTGGCGCTCTTCTTCGGGTACATAAGCGGCCTGTACGGCCTGAACGAGATGCTACGCATGTGGAGCTTCAAGAACTCGTCGATCGCGTCCG
TGGGCATGTTCCAGCAGCTCGCGTTCTTCTTCGACTTTGTGTTCTGTGTGGCGATGATCGTGCCGCTTTTCATCATGTCGGGCATCCCATTCCTCAACAT
TATCCAGACGCGCATGATGTACAACAAGGGCTTCTCGGAGGTCGTCTCGGCCTCGTCGCAGTACGCGTTCTCGCTCGCGGCCTTCATGGGCATCCTCGGC
GGCATGGGCTGCGGCTGGCTCTTCCACCTGTTCACGACGCTCGAGTCCACGCCGGGCTTTATCAGCTACGTCACGACCTACGACTTGCTGGACGGCAAGG
CCGGCGATGGCACGACCACGTACGTCTTCTACTTTGCCTGCGTGGGCGGCACGTTCATCGCCGCCATCACCAACTTCTTCATCGGCCGTCGGCTGTCGAT
CATCTGCGGCGGCGTGCTGGCCATGCTCGGCATGGTGTCTGTGAGCGCTGTACAGACATCCGGTGGCAGCTTCCTGTTCCCAGGCGTGGGTCTGCTGGGC
TGTGCCGTGGGTCTGCTCCTGCCGACGCTCGCGATGTACATTTACGAGATCGCGACGCGCGACATGCGCGGCAAGGCGCTGCTGCTGCTCGGTCTGGGCT
TCATCATGGGCGTGCTCGCGTGCGCGTGGTTCTCGTCGTCGACGAACTCGGTCGGCTGGGTCTGGCAGGTGTTCGTGGCGACCGTAATCCTGTCGATCGT
CACCCCTGCGGTCTATATCTTCCCCGAGAGCCCGTACTGGGTGTACCTGCGCGAAGGTCTCGAGGCCTGCGAGCGCTGTCTGACGGTGCTGCGTCGCAAG
GAGGGCGTGTCTGAGGAGCTCAAGATGATTCGCGAGGAAGAAGCAGCTGGGGACTCTCGCGAAGGCGCGGCGGCCGATAGCGCGGGCACGATCTTCAAGT
TTCTGCTGAGCCTTTTCCTGATGCTCGTGTCGGGGCTCTTCCTGGGCTCGCTCAACATGTACATGTCGCAGAAGTTCAGCACGATCGAGAACGCGCAGTA
CATGTTTGTGAACTGCGTGGCGCTCCAGTTCCTAGGCGCGCTCTTCAGCTTCTTCTTCATGGACCGCGTGGACCACCGGCGCATCCTGTTCTGCACGCT