Description :
From Genome Similarity Track
Location :
Scaffold_764:111- 2018
Sequence
1907 bases(100 bases per row)
CGATTTCATCTGACGATTCTCCATCCGTTGACACGCACGGAGAGTTTCTTCCATCTCATTAATATCCATCAATCGCAGTAAGGTCAGCTGTTTTGCCAGA
TCGCGATCGTCCAGCGTAGCATGAAGTGTTCCACATGCTCGCGACTCGTGGCCGATGTAGCCAGTCTTTCTTCTTTAATCGCCATCTTGGCATGCTTGGC
CGCGACATTAAGACGATGCAAGTACTCCGGCGGGATTTTATCGGATCGCTTCCGTGCGAGGTAATACTGTCTGGCTACTAACACACCTTGCCCTCCATAC
TGTATCATAAAACAATCCAGCAATCGTTTCCACTTGTGCTGTGTAGATCGGCTCAGTTGGTTGTACCAGTTTCGCACGGGTCCCGTCAACAGATCACCGA
ACACCGAACACCAAACACTTTTCTTCATCTGGCGCCTGATCACGCAGGAACGCCGACTTGACCTTGCTGATCCAAATTCTGGCCCGATCTACGTCTCGAT
CTTTGCCACTGGATTCCTTCAGCTCCGTCATCGCTGACACTCGAATGCGTTGGGGAATACCACCACCGTTTTGCAACGTCTCTGTGGTGGCTACCATCGC
ACGTCACCGATTTTCTTGTCCCGAATCATTGGGATCGGCATCTTTGGGATCGAAAATGTCAGATCGACTGTGAGGCGATCGCACCGACTCCATCTCAACA
TCTGGGGTATATGTTTCTTGGACTCTTGCCGGCTTGATTATTTGGCTTGGGTAGATCGCTTGATACGCTCGTTCCCGTTGATCTTGATGAAAACGTTCTA
TGTCCTCATCGAGGTACGTCCGCAGGTGTCCTTGCATAGTTGACGTCATCTCTCCTTTAGCGCATGTGATCGTCGATTGCGGTTCGATCTTGATCGTCTC
AACTCGATCGCGTAGATGTGCTACCCCACTTGGGCCTAGAGACATCCGCTGAATACCGACCAAATCATCCGAATCCATTTCAGAATCAGCCGAGGCGTAC
TGCGACGATCCGGTATGGTATCCTCTCAGGAAGTCGGCGATCGTAGTGGCACCTTGATCTGTGGATTCGCACTTACCCGTCAGGGGGTTCAACTTGTTAT
ATAGCGATCGACACGCGTGGATCACCTGGTCTTGATCGCACTCCAGCATTTTATTCGCGTCGAATACTCCAGCAACGTATCCAGCGTCATGTAGTAGCTG
GATGATCGCATTGATCCCGTCCAGTGGGTTAGTTGTCACTGTCGGTGGAGATATCGTACCTTGAATCTCTACGATCTGCTTGGGCTTCAATATCTGGAGC
ACTGGATTGCTCAATAGCAGATTCTTAAGCGCCTTCCAGTGATATCCCTGCGCCAATCGGTCCAACTGCCAGCCATCCATCTTCATGTTATCGTCCACAA
ACGTCGGTCGATTGATCGATTTCACACTGCGATCGTGTTGATCCGATCTGGGCTCTTCTTTCTTCATTCGATCTGTCTTCTTCGACATTGCCTGAGTGGT
CTTGTGTAGTTTTTGTTCAGTTTTCGCTGAAGCGTTTTCACCCAGCGGATCGTGCTTTGCAGCACGATCCGTGGTGGTCCCCGAATGGACCTCAGGAGGG
GGTCGAGGTTTCTCTTCCAGTTCAATTGATCGATCTTTCTCTTTGATCTTCTTGTCATCAGAGCCCCTTTCTCAAACTCTGAAGATCTGAGGATCTTTTA
AAACCACGCATCTGCGGTGATCCCTCTGCCTCATACACTTCCATTCCAGGTTCAACCTTGACCTTCTCATCTTCACTCAGGGACTCACGGTGAAGTCTTG
AGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGTGGAGTGGCGATAGCTTATTTTATGAGGCGATTTTAACTCTCCACTGGTGCCCAGACGACCGAC
TATCGGA