Description :
From Genome Similarity Track
Location :
Scaffold_1595:111- 1946
Sequence
1835 bases(100 bases per row)
GTAGGTAGGTTGACCAGAGATTGGAGGTCTTTCGGGTGAGCCTTTACTCTTCCGCTGGATACTCGATATCCAAGGTAGTCGACCTTCCGACATCTCTACG
AACTCTTGACTGCGCTGATCGATAAATTTCAGAAGTCGCATACATTCAACAACCGTTCCACCCTTTGTGCATAACGCATCGCACGATTCTGCGGGGATCA
GAATGTCATCTATATATGACCGCTGACCGGGGATCGAGGGAGTTGACTGCTCATCTGGCTCTCCCACCTTGAACAAATCCTCAGACCCATCTATCTCCGC
TTCTGGAAGGGTTTGTAAAGCCCCGTATAAAGCGTTATCCAGAGTCGTTAATATATTTGAGGCGCGTTCTTGAGCCCGAAAGTTGAAGGCCATAGAGGAT
TGGCCAATTCCTAAGAATCAAAAGGACCTACGCAAATGGCTTGGCCTTGCCAATTACTTGCACAAGTATAACAAGAATTACGCTGAGGGATATGGCTCGC
CATTATCCGATCTCCTGAAAAAGGATGTGGAGTGGTGCTGGACTAGCACCAAAGCAGATGCTTTTAAGGACGTAAAGGAGAGTCTCCTACATGCACCGAT
TTTGGCTTTGCTAGATTCTGATCAGCCTTTCAGTGTCGTCTGTGACGCTTCAGATTTTGCTATTGGCTATGCTCTGTTACAAACAGATGTTGAGGGACGC
GAGCGTGTCATCGCTTTGTAATTATTTTCAGCTTAAATCTACTGAAAGAAATATTCAGTATACGACAAGGAGATACTTGCTTTGAAATATGCTCTAGTCC
AATTCAGAGTTCATCTGCTTGGCTCTAAGCCTTTTGTAGTCGATACTGATCATTCTTCGTCACGCACCCGGCGACCCAATTGCCTCACCTCTCGCAGAGG
ATGGCCCGTTGGCTTTCAGTCTTTGCAGAATATAACTTCGAGGTGAAGTATAAGCCGGGGAGGCATTATACATTGGCTGATGCGCTGTCAGGACGTCCTG
ACTATGAGCTTGCTCATGTTACAATTTTGTCGTCGTCAATTAGTGACCCAATCCGTGCATCTTATGCCAAGCATGAACAATGCGTAGTTTTGCTAAGTGC
TCTTGGAAGCGATGAGTTTAAGAAATCGGACATTAAATTGTCGGCACGTTCGCGTGCGAGGATACATCAATATTTTATCGACAACGGCTTGTTGTGCTAT
CACACGGATGTCGCGGATACCCCGCGTATCATTGTTTCTTATGATGAGGAACTGAAGTATTGAATCCTCTATGAGGTCCAAGACACAGCTATTAGTGGTC
ACCTTGGTCATAAGAAGACCTATGGCTTAGTTAGCTAGAGTTATTGGTGGCCCAAACTCTATGACTGGGTAAGCACTTATGTACGTACATGTGAGACGTG
CCAACGAGTGAAACCCTCGGCACATGCGGCTGCGTGGGCTAGTTTTTCTGTACCCTCCGCGTGTTGGGAGTCCATCAGCATGGACTTTGTGTTCGGCCTA
CCCTAAGACTCAGATGGCAACACGAGTATTGTGGTCTTTGTCGACCGTCTGAGTAAAATGGCTCACTCAACGGCTGTGCCGGATTTGATTGATATGAAGG
TACAGCTTTGCTGTTCATTGATCGCGTGTTTCGCCAACACGGACTGCCACTGGCAATTGTCTCTGACCGCGACCCTCGTTTTACGGGCAAGTTCTGGAAG
GCCATCTCCAAGGTGCTCGGCACCAGACTAGACATGTCTACCGCGGACCATCCGCAGACCGATGGTCAGACTGAGCGTGTCAATTGCGTCCGGTGAGACG
CCTCGGCGTTGGAACTCAATGCTCCCCGTTGTTGA