Description :
From Genome Similarity Track
Location :
Scaffold_326:111- 1211
Sequence
1100 bases(100 bases per row)
AtGgTCCGGATGGCGTCATGGAATGTAAGGACGAGTACTTTGATGATCTGCCTCCcATGACGAAAAAAGTTGGAAGTGAGAAGAAGCTACAGAGtcTGAG
ATTGAAaGTTATCGGAAGACAGCAGAGCATGAACGAAGAATACCTTGACAGCCTGATCGCATCGTGTGATGGAAGTCTGGACGATATTGATGACGGGTTG
TCGGAGGTAATTGCTGCGCTCTCGAATGATGAGGATTACGGTGACGATTCTCGATCTCCAGATTTGGACAGTCGACGATGGTCTTTCGATATGCCCCATG
AGTCTGAGCATAAGACCGTGGTCAATCCTCTCGAACGTGCTGACTCCGAGCGCTTCGTCACGCTTGACCACAGCACTCGCCAATTAcACTCTCAATTAAG
CGAGACGAAGGCTTCACCTGAAGAGCGATTCGTCAAACATACTGAAGatCCAGAAGCCAGCCGCATTCCTCCCACTCCAGCACCTGAAATCGGTTGGgAT
CCACTCACGGACGACCGCGATCGACTCGTGCGCAACGTCTCGTCACTCTACGTGTACAGCACACTTCAGTATGCTCTActAGAAGTGATGGGCCAACTAG
AACAGAaTGATGAGGCTATTAGTGAAGATTAGAGCATATGCTAGCTTGATGATGTCTATTCCGTGGTACGTCTTCACACGTCACAGTTTCCGAaCTTTGC
GAACCTCCTGACGTCGTTTCGCAGTCTGTGTGTCGTTTCGACACCTCTGGCTTGCCTCCTCtGTCTGCGAGACACCTTCACGAGCCCCgTAACCCCACGC
ATCTCGCCTTGGAGCCCTCATCATGTCAAACAGAAGCGAGAGCGTTCGTGTGTGCGTGCGAATTCGCCCACTAAGCACAAAaGAaAaGCAGGACGGgCGC
CAGCAGATCGTTTTtGCTCATGCGTCGACGgCCGAGATCGAGCTCGTCAaCCCcGAaGCcGAcGGGgcTGAGCCACCAaaGAAATTCACATTCGATGCTG
CGATCTCGCCAGActcATCGCaGAtGGaTGTGTACAAcaaggccgcgaccgatatcgtcgagtcggtcgtgaacggNNNNNNNNNNNNNNNNNNNNNNNN