Description :
From Genome Similarity Track
Location :
contig_66:110998- 112188
Transcript NameFunction/comments
g11823.t1ETI51284.1 hypothetical protein F443_05349 [Phytophthora parasitica P1569

Sequence
1190 bases(100 bases per row)
GCGCGCTCTCGTCAGCGTGCGTGGCCAGCACGACATGGTCGCACTCAATGCGTTCGCCACCCTCAAGGATGACGGCCTTGCCACCCTTCTCAACCTGGTC
GACGGTGGCGTTGTAGCGCACCGTACCATTGTACTCTTCAGTAAAAATCTTCAGGAAGGGCTCAATGTAAGCCGAACCAATGTACCACCAAAGGTGCTTC
GGACGAGCCGAACGGCGACCCAGCGTACGCATGACCACCTGCCACAGCGGGATGTACAGCGAGTTGGAGTGCGTCTTCAACGCGCGCAGGAACTGCGTCA
CAGGCAGGTCCAGCACGTCGTTCTTGGGTACCGTCCACAGCACGGACACGAAGGCGAGGAAATAGTGGTGGAAGAACTCCTTGGAGTACTGCCCCTTGGC
GATCCACTCGCGAGTGGTGATGTCCTCCTTCACGGGCATGGTCATGAGGTCCATCGTGAAGCGGTAGATGTCACGCAGGACACGCCAGATGCGGAGGTCG
AAGAGGTTGAGAAACTACCGTGGAACGGAGCACGGGACGAGAACTGCAAGTCGCCCTTGATGTTGGAGCTGACCGTCAGGCTCATGGGAATGCGCTTCTT
GGTGGTTCCATCGGCCTCTGTCAGGCCAAGGGACTTGAACCACGCCTTGACGTTGGGGTTCGAATCACCGAACATCATGAAGCCGATGTCCACCATCTCG
CCGTCGATGTCCATCTCGTACGTGTGTCCACCGAGCGTCTCGTTCTTCTCGAGCAGTACGACCTCGTGGCCATCCTTGACCAAGTGATAGGCGGCGGAAA
TGCCACCGATGCCGGAGCCAACAACCACGACCTTCATTTTTTCTTGAGTCCTTACGAAGCAACAGAAGCAGCTATTGCAGACACGCGTCCAATGTGGAAA
TGACAAGCTCGGTGCTGCGGGTGCATTGCTAGCCAGAGGTTCGCCGTCGGCGGGTACGTGCAGATAGCAGTTGCTGCTTGCTACAACTTTTATCCCCATC
CCGTTGCTTCAGTGGACGAGCGTCCGCTCGTCCACTTACAAACGTCCAGTCAACGCAACTCGGATCGGAGCGGGCAGCGGACAGAGAGCAGGCCACCACA
CGTCTTGACTTGGATTTGTAAGCGCCGGCAGCAAAGACGAGTTGTTGAAACGTTTCTCTAGCAGACCCATCGAGACGAAACCTGCCTTGC