Description :
From Genome Similarity Track
Location :
scaffold_90:11099- 13104
Transcript NameFunction/comments
Pl_110011NADH ubiquinone oxidoreductase, putative

Sequence
2005 bases(100 bases per row)
AGCCAACACTTGCAACGAGCCTAACGACGGCATCTTGTGCAGCAGCTGAGTTTTCTACGAGTGGTGGGATAAGAAGACAACAGCACGGAGAGGAAAGCGA
TGGACTAAATGACTGCACCGCCAGATGGCGGAAGCAGAGGGTGTCGAATTCCGATGAGGTAGAAGCTCGAGGGGCTTGAACGTGGTAGAACGAAGGGGTC
ACTTGATGACTGGCGTGACCGTGACGACGCCACCTGCAGACACTCGCCTCTCCCAACGTTCGTGGATGTGCACTAGAGATAGTGGAGGTGGTATATATAG
CGGCATGAAAATACTCGATGGCAGTGGAATAAAGAGGTCCTGGAATGCTGGAAAGAGACGGCATGAGGTGGTGGACTGACTTACGCTTTCAATCCTGTAG
GAAGCAAAGTGCACGAATGCTTCTAACCTGGAAATTCCATGTATATACGAGGAAACCAGAACTATCTGGATGGCAACAGTAGTTTATGGACAATCGTGGA
TTACCAACTCTTTAATTCTCTGAAGTCTGGATTCCAACTCCATACGAGTTGCAAGACATGCATTTTTTAAAGATTCGGGTACGTGGTTGACCAGCACTTT
TACACGTGGTGGTTCCTGCAAGTATGCTGAACAAACTTCTGTTGCAGATGTTGCAGGTACGAAGCAGGTGTAGGAGATATTAATAGACATTTTCCACGGC
AGCACCGCGATTGCAGAACCAATAAATTGGTGGGGTCTACCAACACTGTAATGTCGTTTATCAAAGAACTGCAAATTTTATTGTGAAGTCCTTTCAATCA
ATCCTGAGGCACAGACAAGATCTTGCCAAGATGCAGCAAATTGCCTTCTGTGATGTACGCCACACCAATAACTGCAATCCATAATAATACAGATTTTGGT
GGTGTCTCCCAATCGAGCGGTCAGAATTGCTTGACGACTATGCTGACTCTCGCTCGCCGCTCCGGAGCTCTGGCCCGGACTTCCGCTGTCCGCTGCGCCT
CAGCAGTCCCCACCACGTCGTCCTCTGCACCTGCCGAGCGCGGCAACATCCAGGATTTGCTGGCCGGCAACGCGACGGCTCGCAACGGCGTCGGTACGAA
TATGTCGTGGGGAATCTTGGTTCTCTTCTAACTTGCCTTGTGATAGAATACGTCGTGTCCCGTGTGGATGATCTGGTGAACTGGGGCCGCAAGAGCTCGT
TGTGGCCCATCACCTTCGGTCTGGCCTGTTGCGCCGTCGAAATGATGCACTCGGGTAGGTGAAATTCCCTCATTTACCTTGAGTTTGTCCCTAAGTTTCT
TGTTGCAGCCGGTTCCCGTTACGATTTCGAGCGTATGGGTATGGTGTTCCGTGCGTCGCCCCGTCAGACGGACGTGATGATCGTGGCTGGAACGCTGACG
AACAAGATGGCCCCTGCTCTTCGTCGTGTGTACGACCAAATGCCCGAGCCCCGCTACGTCGTGTCCATGGGTAGCTGTGCCAATGGAGGTGGATACTACC
ACTACTCGTACGCTGTGGTGCGTGGTGTGGATCGCGTCATCCCCGTGGACATCTACGTGCCTGGCTGCCCGCCTACGGCTGAGGCGCTGCTCTTTGGTCT
GATGCAGCTTCAGAAGAAGGTCAAGGGCAACAAGTCGCTGCTGCTCAAGTTGAGGAAGTAGACAGTTCTTTGGCTTTCGGGTGAGACGCTACTTAGCTTC
TGTATAACGTTGAGAGAAGACACAAGACAAAATGAATTTCGATGAACACACACAAGCAGAAGGTAGTTGTACGTACCACACACACCGTCATGAGGTGAGA
TGAATCCCTCTTGAGACCTTGTGCACAGAGTGGAGCTGTGATAAAGGTTAGACCCACCCTACAGACCACCTCCATGTTCTTGAGTGGCGTCTTGACTAAA
CTGACGCGGAATAGCATAAACAAACCGTGACCATAATTGCCGTGACTTGGTCCTATCCGATACGAGGCCATTCAAACAACCGGCCTCCTGCGGAATACTA
CTGCG