Description :
From Genome Similarity Track
Location :
Scaffold_194:110906- 113653
Sequence
2747 bases(100 bases per row)
TATAAATATAAATCAGTTTAAAATTAACCACGTCTAGCACACTTGGTCCCCTGGACAACCGTGTGCTAGAGATTAGTTAAGGAATCAACTTCCTCTGTGA
TTGTGCTGTGTGACCCCGTCACACCCTGGTAGGACTTGTAGTCAATCCCGCGACCAAGGATTGATACAATCCGCAAGTCGTATAACATGGATGACTTGGA
AAGTGAGATGCCTTTGAGGCATGACTATACTCATCTTCCGGATGCCCATTGGGCTACGTTGGAGCGAATGGTTAGCCTCTTAGGCAGGGAGACTTTCGTC
GGGTTCCCCTCCCTAACCGCCGAGCAACAGCGTGCTCGGATGGAGCGATTTGAGAGCTATGAGTCCTCACTCATCGTTCATGTGAGCAAGACGGCGCAAG
AGGCGGCTCGTGCCGTCGTCAGAGCCGAGGCGCAGAGCGCTGCTCCGACGCAGGTGTCGTATACGCCACGTCCAGAGTCCTCGAAAGCTGTGAAAGTTAG
TGTCCCTACGTTTGATGGGAAGGAAGCGGACAGCTTGGTCTTTTGGATCAGGGAGATCGAGATCGCGCTGAGCGCAGGCTAGATTCATGACGCGAGGTCC
CAAGTGGCCTTTTCCCTTTCAAACCTGGGAGGTCGGGCAAGGGCGTGGGCTATGGCCAAAGAGACAGCCACTCCGGGATACTTTGTCTCGTGGGAGTTCA
TGGCGCAGGAGATGCGTCACACATTTCTCCTGGCCAATGTGGCGTACCGTCATCGGTCTTCGTTCTTGCGGAGAGCAAGGCAAGAGGTCCTTGCAGGACT
ATGTCATGGAGCTTCAGAACTTGGAGGCTGCCATGGCAGGGGCTCCGTTGTCGGAAGAGGTGAAGGTCACCGTGTTTATGGATGGTGTCCGGGTCGGACC
CGTCCGCACGGAGCTCTTTCGTCGTCAAGCAACCACGTTCAATGAAGCGGTACATATCGCTTTGTTGGAAGATCACTGCATGCGGTCGGCCCAGGGCCAC
ATCGGGGCTACGGAGGCCTCGGAGGGTTCTACCCCCATGGATTTATCGTCGGCTGAGAAGACTCGCCCACGTTGGGGTGCGTCAAGGGCCGGTGGCCGCT
GTTTTGGGTGCAATGCGGTCGGGCATTACCTCAGAGATTGTCTTAAGAACCCGTGGAAGGTTGTCCACGGCAAGCCAGCTTCAGCGAAGCACTCTTTTAA
CGCCGTAAGCGTTGTAGAGTCGGGAAACGTCGACTCCCAGTAGGTGCGGGACGCCCTACTGGGAGGTCAATGGCTTCCAAGACGGGAGGGAATTTACCCC
CTCCTCTTCCTGGAGAAGATGTCCCGGGGACAACACTGTTGTGTTTTTCTGTGGCCGCGGTGCGGTCAAACTTAGTGGTGGTTACTGCTAGGGTGAAGGG
GTACAATGACCCCATGACGGTCTTGATAGACTCCGGCGCGTCATATAACTTCGCGACGAAGGCTACTGTGTCGAAGAATTGGGCGCTGTATACCAAGGCT
GTAGAAGACTCCAAGAGTAACAGCAAGGTGTCAGTTTCGCTTAGCGACAGGATCGATTGTATCGACTCGCAAGGTTTTGATACCTTTGGTAATCAAATTT
GCAGTTTGATTCAGAAGTACCGTTCATCGTCTTGGATATGGACGATCGATACGATCTTATCCTTGGTATGCCACGGCTTATGAAGCATGAGCCGTGGATC
GACTGGCGTAGTCGCACCGTGGGTGCTAGTCACAAACCTTTCGTGGAACGAGCTTTGGTGGGTCATGTCCCCTCCTTGTCTCGCGATGGATTTGTGCACG
AACATCACATCCCACTTTCGGAGCTCCTCTTTGCCGGTTCGGCAGAGGCAATGGGTGAGCAAGGTTGTCGCGGATCGACTGATACCTTGGAAGTCGTTGA
GGCTGGGGAAACCTCCGCACGAGAAGTCGCAACCGTGGGTGGTGGTGCAAGTGGTAGTGCTGTGGTCACTATCGCTCAGGAAGTCGCAACCGTGGGTGGC
GGTGCAAATGGAAGTACTGTGGTCACTTCAGCTCAAGGAGCAGGTGTCGTTGGACGACACATAAATGAAGGAGTTGTGTTTCCTCCTTCATCGGAAGACG
CAACCGTGGGTAGTTTTGCAAGTAGGGGTGCTGTGGTCACTCCTTCACAGGATGTCGCGGTCGTAGATCGAAGCGGCTTGGATAGGATTGCGGTGGAACC
GCTTCCCAAGCTCGAAGAGTTGTACGGGCTTGATGAATTGTCCCATCGGGAGTTCCTAGCGGCCTTCAAGGAAGGCGCGTTAGAAGATGTGGTTCTCATA
CGTCAGGAAGCGACGTCAGTGGAGCTGAACAGTTCTTCGGTCATGGACCCAGAAGTGTTGGATGATGAGAACAAGTCTCATCTTCAGCAAAGGTATGGCT
CGGCCATCTTGAAAAATCCAGCGGATCCGTTTTATCCTCTGCTAAAGGAGTTTGCGGATGTGGTCTCGGAAGATCCTCTGTCAGTGTTGCCCCCGGATCG
GGGTGTACGGCATGAGATTGACCTGGAACCGGGTACTAAGTACTGTACTACGCGTCAATGGCCGCTGCCCAAGGAGCAAGTGGACGCAATAGATGCGTTC
TTTGCGGCAAAACATGCTGCGGGCATGGTTCGAGAATCGAAGTCGCCACATTCGTCCCCAACGTTCTGTGTGCGGAAACCTAATGGGGAAGTGGCGCATG
GTGCATGCTTTTAACAAGATGAATGCGGCTACAGTTCCGGCGTCGAC