Description :
From Genome Similarity Track
Location :
Scaffold_57:1109- 4437
Sequence
3328 bases(100 bases per row)
ACGTACTCCTGCTGCCCCGTGGCATGCCTTTAGTGATTTAGACCTGGCTGCGTTTAAGACACACTGCTCGACATGGATACTGGATGACGGCTTTCCTTGC
CCCCATAGACGACCTCGTCAATTCTTCAACGAAGCAGGACTAACTTGGACTGTGGTCCATGCGCGATATCAAGATGATGTCAAGCGCGATGATCCCAGCG
CTCGCACAATGAGCTACTCTCGTTTCATTCAATACGTCCGCAAATTATATCCCGGTGTCCGTCTAACGAGAACGACAGAAGACGATTGTGACTGCTGCAC
TCGTTTAGATATTCAGCTTCGACAAGAGGATATCACTCCTGATGAACGGAAATGTCTTCTTCTCCAAAAGCAAATGCATCTTGCTGAAGCTATCTCCCAA
AGACGATTTGTTTCGTCGTTCATCAGAAACTATACGGCCCTCCATGCACCAGAGCAGTACCTGCCTTGTGAAATCATTCCGGATACAGCCGATGACAACG
ATGGCAACGTGGACTGTATGGAAAATGTGGATGACGCCTTCGATGCTGCTACAGCCGAGTCAGGCGAACGTCCCTCGAATCAGCACTGTCGGGTGCAAAT
TCAAGCGGAGGACTATGGTGGTGGTATATCGATGCCTTACTTTGGCCACTCTCGCCCGTCGATCGACTATTATAACAGCAACCTCATTTTGCAGAACTTT
GTCGTGGCAGACACCAGCAACAGCGTCAACCATGTCTTTTTCTACGATGAGAGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGCTAACTATCTGTTCGAGATTGATCAAGGCACTTGTACCGCTCGCAAAACCGTTGGTACGCCGGAATCGGAGTCAATCTCGTTCGCAATGC
TAAGATCTGATAACATTGACAGTATTCGGAGGGCCGTCTTGGCGGAACTGTTTGGTCCTGCTGTCACAGACATACTCCAGGCGTCAATTGCGTCTGTTCA
GCTTCCACGCCATCCGATCAAAGAGCTAGCGGAAAAGAAGTTGAAATCGCTGTCGGCCAAATACTTCACAATTCCACCACAATATCTACACTACTACCCG
AGCGTACCGGAAGCCATTCTCGATGCTTCAGTTCAAGCTGATTCCATCGCGGAGACACCTGATTCAACTGATGAGGGGAGCCAACAGCAAAAGAAACCCA
AGCGAAGACCAGGCCGACCACGCAAAAACAACTTACGACCGCGCAACAGCCAACCATCAATGCTGCAGTTCTTCAGCACAAACACAGCGGATAGATAGTA
CGTTACTAGGCTACCTCATTGCACTCCAACTAGTAGTAATATACATAACTTCATGAATACCGGTTTGTGGTGAGAGCACCGGGGTCCCGATGGGACCCCG
GGGTCCCGCCATTCGTTTCACTTGTAGCGGTCGGGCCAGGCTCAGATTGCACGTGTAGCGGCCTGCCACGGTCTATTTGTTGTGAGCGTCAACCTGGCGA
AGGCAATAGGAGTGCATATCCGAGGCCGGTGCAAGACTGCTCTACTTATGGTAGGTAGGTAGATCGTGCGGTTTGTGGTGCTTGTGGAGCAGCGTGCGGA
AGCAGACTCATGCCGGGCACTGTGGCTCTGTGGCTCGTGGCTGGTAGGCTCTGTGGCTGGTAGGCTGACAGGCACGTGATGCAGTAGATGTGGTATGCGG
GTGGTAGGATCGGTAAGTGGGGGTGGGTCGCGGCAATAAGTGGAGGAGGGCGAAGCAGCAGCTAGGAGAGGTTGTGGAGGTGGGTGATGTGCGTGAGTCT
GTTTGATGGGTTTGTGTTGTGGGTAGTGCGTTTTTCTATTTTGTGAAAAATGGTATGTTGCGTTCGGTTGTAAGAGCCCCTATAGCTCAGTGGTAGAGCA
CCCGCTTAGTAAGCGGAAGGTCGGTAGTTCAATCCTGCCTGGGGGCAAATTGCTTGCAATCGTTTCACGCTCGAGGGTGCTGTTGCGTCCCGTTCGTGCT
CGAGGCGTGCTCCTGGCCGTCTTTGCTCTTTTGCGCTTGCTCCGACACTGCTCCGGCACTGCTCCACCCCACCCCCTATTGCTCGCACGTGGACCCTCAT
GCCACCCCCCAGAGCCACAACCCCTACGACTCCCTCCCCACTGGATCTGTCCGTTTAGTGGCACTTGTATCGGATGTCAGACCGGACGAGCTGCCACCTG
AGACGCTCAACCCGTCATTCAGTCGGCCGCTCAGTCAGTAACTCAGTAACTCTGCTTTGGCTTCTCAGTGCTTTGGCTCGCAGTGTTCTATGATTGATGC
AATGATCCGTCTATGTACCGAGGTCGTTGCGAAGTATGTGTGCCAGCCGGCGCTGCATAGCGCATCGGACAACCTATTCACAAAGAGTATCTTGATCCCT
GATGAGCGACAGATCGTGTTCGAAAACGCCGAAGGACGAGACTTGGTCTTAACACCGCCGCAGATGACTCGTCCTGATAAAGCTCCGATCAATGGAGATG
AAAATTTGGATGACCCTGGTGACTTAGCAGATGAGAACAAGACCCTGGAGCGTTGGGGAGAATTCTTTGATGAGGTATTCCAGGACTACGAATTTGGTGC
TGAATACGTTGCGACAAAAACGGATGCTGATGTCAAGAAACAGGGGATGAACAAGCTTGAAAATATTACTGAGTCGGACAGAACTCCGTTTCCCAAAACA
AATCAATATGCTTTCCCTTCTGAGACTATGCTTAGCAGGTTTCAAAGCTTGGAGGTAACATTAGCAGAGCTCTCCGGCTGAAATTCTTACAGGTAATTTC
ACTGCCAACGGTGATTGTATATTCTATCCTTGCTGCTTCATGCGTGCCCGGATCAGCGTGATCTCATTCATCACACCACCATAAAATACACCAGGTCGTC
GCTCATCGATGCCTTCTTCAGTGACCGCTCATCACTTATCTCTTCGCCCGTGTGCAGATGACGTTGATGTTATGTAGTTCGTCCTCCATTCGTCGGCCGC
ACGGTTACTCGTTGGTCAAGTCGCGCGCTCCATCTGGACAGTAGTCAGCCGTCGACCCCAGCTAATACAGCCGAACTGACCCACCTCGTTCGCCCCACTC
GAGAGGTTCTTGGCAGTTCGTGCGTGTACGTCCGCCTCCAACTCCTCGGGCGTTGCAAAATGCTCGTGAAGGTCTTCTTGTTAGCGATGATCGGATGAAA
CAACTATTCCAGGCACCGCACCATCATCAACATCACGTCTCTTCACTTGTGATGGGATTCTTGCGCTGACGGCCTCCGTGGGACCCCGGGGCTGTGCTGC
CTGTTCATCGTTGAGCACAAGCGTATTG