Description :
From Genome Similarity Track
Location :
Scaffold_1484:1109- 4210
Transcript NameFunction/comments
Phypl_g13526hypothetical protein PHYSODRAFT_354940
Phypl_g13527hypothetical protein

Sequence
3101 bases(100 bases per row)
GCTCGCTCTTGGCGCCAGTATGGGGGGCGCCAGCCAATGGGCGTGTCTGCCCATCTTTCCTGTTGTGATATTTGCCAGGAAAATCGCCCATCCCGCCGAA
TTTAGAAGGGAACAAGTTGGCGTGGCGCACTCCACGCACCGAGCCTCGCGCACTAGCCCAGCGCCGGGCCAGTCCATTCGCCATCTTGCTGGCCACGACT
CACTCACTCAGACAGAGCCCCGTGGTAGCCCCGGTCCgttccgccgccgccagtcCAGACAGGGAAGCACCGATCCGCGCCGCAGAGCCAGACgcagcgc
ggccgcgcagTCAGAGCACAGGGAGTGCCAGGGAGAGAGCTAGGAGAAGCAACGTAGAGCAGGGAtggagatcgccaagaacGTGCGCGACTTCCTGGTC
GGcatgaaggaggcgctgTCCCCCGAGGAGGAccagctgctgtcgagcctgcagacgctgcacgagcagtACCTCAACATCATGGAGGACTTCTCGGTGC
AGGTGTCCGCCCAGGCGCTGAGCATGAGCCCCGAGGCGCGCGTGAATGCGCACCAACTGCGCCTCAAGATCTATCAGGACTGGCGCGCCAAGTTGATGGA
GCGCGTGTTCGACAACTCCAAGGAGATCGCGTCGGCCGAAGACGCGGAGACGCACGAGCCCGGGTGCGACTGCTGTTTCtgcgagctcgcgctgcggctg
AGCAGCTACGAGACCGTGACGGCCGACTACATCCAAGCGAGCACCCGGATCAAGAACCCGGAGAACGACGCCGGCGAAGACagcgtcttccagctgccGG
ACTTCCTGACCACCTAGGCGTCGCATGGCCAAGCACGCCAAGCTAGTTAGGGATTTCTCGGCAAGCGAGTGCGCCGGGAACGCCCGCGGATCTCGTGTGG
AACGAAGAGAAGGACTGCATCGCGAGATGGGACCGCCCCCGCGCCTCGGGGAGGCTGCCGAGCAGTACAATACGTGGAACtactacaacaacaacaacaa
gagGCGCTCGCGCGGCGCCGCGATCGTGGAAGTCGCGGCCGCCCCGGCGCGGGCGAGTGGGTGTGTGGAACAATAGAGTGCGCCGactgcgtcttcgccg
tcaccggaAGCGCGTGCATTACAGTCGGTAGTGGTATTATGACCCCCCGCCTCGGTGCGCAGGTTTATAAGCAAGTTTATAAGTACAAAGGGCTCGTTTG
AATCGTTCGCTAGTAGCGCGCAGTGCGCGGGCAGAGGGGAGGAGGGATcgacaccagcaccgccgcacGCCCCGCTCTGCCGCTGCACACGCGCCAGCGC
AGGAGGAAACGAGGCGAGCCAAGCAGAAGAGTACGCGCGCGTGCGAATAACTCGCCGAGAATGCAGAGAGCTTCAGACAGTTCGTTCGTTGTTGtggttg
gtgttgttgcAGTGCTTTACCTCGCCGGGCATTCTCCGTGGGCCAAAAAGTATCATTTCTGCGGTGCCGACCGCCAGCGTGGCCCGCTGAAGCCAGCGGC
CGAGGTTGCCACATGGCCTGCCACGTTGCGAGCGGTGAAACCGCGGCTGGCCATTTCGACGTGCTGGGCCCAGCACGCCGGCGCGCCGTCGAGAGCGGCG
CCAAGGTACATTATCCCGGGGGCCGCCACTGGCGGCGCCACTGCGTCGCACGCGGCCGCCTGGCGGGAGCCGCGCTCAGAAGACCGAGCGGCCCGTACAG
TCTTTGGCTTGGACGGGCTGGCGTTGCACATACGCCAGCTTGGAGCTCGGCGGATGACCTCGATTTGCGCAAAGAAGCGTATGGTTCGATTCGAAGCGCA
AAAATTGGGCTTCAGCGGAGCCTGCGAGATCGCATGCGTCTTTGGGTACGGATATATACGGTATCGCAGTTGTATCAGGACccgcagcactcgacgaGTA
CAAACCTAGCCGCGCGACCCCGACGTGCGCTTATAGCGGTATATCTGATTTCGCAGACATCAGGTTTGGCAGTCGTCGCGGGCCGTTGAATTTCCAAGTG
CGAAAATGATGCGAAAAGTCTGGGTTCTCCTTGATACTTGCCGACCAGCGGAAGACGTGAAGCCGTTTCGTGTCAAGCGCTCTTCAACGAGTAAGTACAc
gtacgtacatgtacttggcTGCGCACTGCACACACTTTGGGCCCGACGCTGCTTGGCGCCGCAGGTATCAGTGCCTCCAAAGAGCGGGCGGCCCTCTTTG
AGGCCGTTCGTCCACCAAGAAGCCTCACGGCCGTGCGCGCGAGGCTTCTTGGTGCGCGATGTCCTCCAGTTGTTGCCCTTCTCTGCCTCGCGGGTTGCAG
TCGGCGACTGCAGTCGCCAGCGTGGCCGCTGGCGGTCGGTCCAAGCGCAGCGGCAGGGCCCCGGTTTCGCCAATACCACTCGGTGACCGCAAGTGACTCT
TTCCTGCGAGCATTGCAGCAATTGAGTGAGTCAAGCTTGCCAAtccggcggcgtcgctgaagaagacggagtCTGCGTCCGCCGGCTGGCGCGGGCCTGT
CCACCGTACGGTGCACGCTGGTCTGACTGCGTCTGCAGACTCTGCACTCGCACGATCCTCCGTATCGTTATCATGCCGCTCGGGCTCGGAAAGAGATTCT
GCTCCGTGCAGTGCTCCAAGATGGAAAGCCGGACGGGCTCCCGACTTGATTCGAGACTCGCCGCGACTTTCCAAGGCGAGCAGCGTTGGGGGCGCCACAT
GACCGGCAGCAGGCGCCACAGCCCGATTCGTGACAGCGCATTGCGGAGATATCGCATCTGCTTGCAGCAAGCTTTCCCTTGCCGGGTCGCCGCCCTGCCG
GCGAGCAGATAAAGGCCAGCAGTACATTGCTGACGAGCTCAGCACCATTTTCGTAGTCGCGACTTTTCAAGGCAACATTCTGATTAGCATGGCCGGCGAA
ATGTGACGACAACCGGGACTTTCTGTTGCGGAGATGGCATGTGATGGAGCGAGCCTCGTTTGCCTCGCGCGACGCCGTAGCACAATCAAACGGCGACGCA
CGCGCGCCAGCCACGTCCTGCCGGCGCTTCTGCGCGGAATAGCGGCAACGCTGTGTGAGTCAAGGCGGCGACAAAGCGTTGTTGCGCTTAGTCACCACGG
C