Description :
From Genome Similarity Track
Location :
scaffold_62:11089- 12392
Transcript NameFunction/comments
g2472.t1 hypothetical protein PHYSODRAFT_525772

Sequence
1303 bases(100 bases per row)
GGACGATATGGTCAAGAACGAGCGCAAGATCTTCTACATGTTCATGTTCCTCAACGGCTCCGTGCTGTGGGCGTACTACTCGTGTCTCAGTGCTCAGGAT
TTCTACACGGTTCAGTTCGCGGATTCAGGCCTCGACTTCTCCTTCCTGACGACGCTGGTCACCTCGTGGCCCATGGTTATCGGCCAGGGAGTGCAGATGA
TCTGGGGTCTGGACAAGTCCATCCAGCGCCAGTTCCGTGTCCACGTCGGCTACGGCATCTTCATGCTCATGGCCGTCCTCATCATGGTGTTCAGTGCTAT
CAACTTCTCCAACCAGAAGACCGGCGCCATCCTCGTGCTGGTTTGTTTCGCCTGCATCGGCTTTGGCAATTCGCTTTCAGAAGCCACGTACTACACTTTC
GCGGCGCTGTTCCCGGTCCCCAAGTTCTCGCAGGCCGTGCAGATCGGCAATGGAACCGCTGGAATTATCAACATCACGCTGGCCACGGTTCTACGTCTAG
CAGTCGGCGGCGTCCACCAGACCAGCAGTTCCACCAAACTGAGCTTCTACCTCTTCTTCGGGATCCTTATCGTTGTTCTCATTGCGGCTCTGTTCGTGTA
CTACCGCCTGATGAGACTACCGTGCGTCAAATTCTTACTTGAACGCAACGAGGAGTATATGAAGGCCGAGAGCTTAGAGACACTACCAGTCGGCAAGACG
CTGAGCAATCTGTGGCGTATCTTCTGTTTGATTTGGGTTCCTGCGCTGGCACAATTCCTCGTCTTCTTCGTGTCGTTGGCTGTGTACCCGGGCTTTGGTT
GTGCTGCTGCACGTAACCTCGAGCCTCCGTACGCCAATGTCACGCACACAGTCACAGAGAACTGGTACTGCTCGCCCGGTATTGTCGGTAGTTACAACTA
CGGCGACTTCTTCGGCCGTGTCTTCACTGGTGCCGTCGTGTACAAGTTGTTGAACAGCCAGTGGTGCTTGGGTCTGTCGATTCTGCGACTGGCGTTCATT
CCGCTGCTGCTCATGGGCGTCGCGGGCACTTCGCTCTACTCCTTCGACTTCGATGACATGGGAGCGATCGCTTACAACATCGTGCTGAACCTGGTCATTG
GTCTGACGAATGGTTTCCTGTCGACGGTGACGATGGGCGTGGCCCCACGCATGCTTAAGCCTGAGGACCGCGAGTCGGGCGGTGCCGTGATGGTCTTTTG
CCTGTTCTTTGGCATTGCTGCCGGCTCTACCATTGGCTTTTTCTTCAGCGATCAAGGTTGGCTCGGACTGTAGGAAGCAGCGCACGTTGTCGTTGTTGAA
TAT