Description :
From Genome Similarity Track
Location :
contig_162:11086- 22440
Transcript NameFunction/comments
g13953.t1hypothetical protein
g13954.t1hypothetical protein
g13955.t1XP_002907583.1 DEAD/DEAH box RNA helicase, putative [Phytophthora infestans T30-4

Sequence
11354 bases(100 bases per row)
TTGCCTTCTTCTTCGCTGTCGTCGATGCCACAGGCTTTGCCTTCCTTTTCGCCGCCCTCGATTCCGTCTCCTTCTCAACACTGTCGACATCCATCTCCTC
CACTTCCTCGTCGTCATCATCATCTACTTCGTCGGGATTAAAGTCGCTGTCGTCGTCCTTGGTAGTTCTCGTGACAGCCAGTTTCTTTCCAGAGCCAGCG
GACGTCTTCGCGGCAACAGCTCGGCGCTGCTCGGAGACTAGACGCTTCTGGGCCCTAAGGTAAGAAACGTCCTTACCCGTCGGAGGTCTTGCCGGAGGTT
TCCAGGTCTTGCGGGGGGCAGTGCGCGGCTCTTCAGCCGCTGATGGCGCCTGGTTGTCGTCCCTGAAGTCAACGTCGGTGTCGCGCTCTCCGGCCAAATA
GGCAGCATGTTCCTTCACAAGATGCTGCCGCTCCTCTGGGTTACGACCACCCAGACGTTCCAGAACGCGCTGGTGCTGAGCTCGGGATTCTCGCCGGGCC
TTATTCCTCGCCATGCGTCTCCTGCTTTCTTGCGTTCTTTTTATTTTTCTTCAAATGAACACCAGCCATCTACCGATGCCAGTTTCGTTTATGAGCGGTT
TATGCCTACCCCTGTGCATTTGCGGGAAAGTCTCGGCTTTGTCAGGATTTGATTAAATTTGAGTTCACTATACTTAGCCGTTTTCCGAGCCAACCCCTAT
TCAAACATGTTGTACGTACAACATGATTCATGTTGTCAAATACAACGTGTGGGCGTAGGGGGGTTAACCCTTTCGTGAGCCACCTACCTTAACTATACTA
TACAAAGTTAAGATACTGGTTTGTAGAAGGAGGCAAAATGCCTCCTTTTGAGGTGGTGATGGGCTCTCCAGCTAAGTACGCAGTCAGACAACACGACACC
TGTAGTTACATTTTGCGGTAGGGCTCTTGTAAAAGGAGGCATTTTGCCTCCTTTTACGAAGACACGGTACTGCGTCGGCATGTACCTGATTGGGCAGATT
CGACTCCTCTTCAGTGATTGGTCCAAACGATCCAATGAAACACCACAAAAACCACGGCCCCCCAACGTAAATTTCCCATCGCATATGGTATCCTTGCATA
GACGTGCATCTGCCGGGAGCAATTATGTGGAGCATTTGTCTTTATTAAACTATACCGACCACTCTGAAGGCTGTGCAAACCGCTCATTTCCTGATTTTTT
TCTCCCTGTACGAAATGGCGCGAAAGCACGCGCGCGGAGAAGAGATGCCAGCCGAGCCAAAGCGGCGGCGACCGCGGTGTGATGCAGCGTCCCAGGACAA
TGACACGGCACGTTTAACGAGGGTGCTCGACTTCAACGGCGTGTGGAAGGAGCTGAAGGCTGCTGGATGGACGCATAAACTGCCACGCGGTCTTGACAAC
CGGTATCGGTACGTGCTACCTGGTCGCTCTGCCAATGGAAAGGATGGCGAGGACTTCCTGCTAGGCGAGGAGACTGTACTTCGGTACTTCATTCAACACA
GTGCTTCAAGTGGCGGTGATGGCGGCGCGGCGACGGCCACGGCGGGACGGCAGCAAGCAGTCGGTGGCGCGCGTGGACTTGGCGATGGTGACGGCGGATG
CGGTGGGACCGGCGACGATGGCGGTGATCGTGGACCTGGTGACAATGGTGTCTGCCGCATGGCAGCAAGCCATTATTCACGTGAGCCTGGCAACGATGGT
GTTGTCGCGGCATCAACCGGATGGCAGCAAGCAGTTGTTGACGCGCAAGGGCTTTGCGACGATGGTGGCGGCGTTGTGGCAGCGGGACCTGTCGGTAGTG
CCCGCGGTAGTGTTCGAGTTCGTGGGTGTGGGCGTCGGCGCGGTAGTGGTCTTGGCCGCGGACGCGGAAGCGGTCGCGGAGATCGAATTGTCAGGAGCGT
GATGGAAGAGGCGGCTACCGCAGCTACCGGGGCGGAGACTTCAAGACGGCAAGCGAGCTTGGTGATTGAACCCAACCTAGAAACCCCAACGAGTGTCCCC
ACGCGCAGTACGCCGCAGAGACGTACTCCTCCTGCCCCTTTGATGGAGCATCTATTCCTAAAGAAGCTGGTGGCATTTTCACCGTCAAAGGAATTGTGGA
TGAAGGAAAATATGTATAGATGCGTGGGCACAGCCTTTATTGTCGGCCGTGTGTGTCGTCAGGTCAAAAAGACGAAGAAGGGAGGGGTACTACAAGTAAT
TTGGCTAGATACGCAGTTCCAGAATGCAGTTGAAACTCTGAGTGTGGCAGTAATTCAGCGCGGGATCGAGAACTACCAGGCTCTCGCGCGCTCACCCAAC
AAGCCGGCGTGGCGTGAATTGACTGATACAGTGGTGGAAGGGGAGCTGCAGATGGAGGAACCGCTCGATGAACTTGAAGTCGCGTCAGACGACGACGGTA
TGGAAATGTACGATCCAGAGCGATTTTTGCCCGTGAGCCTTGCGGAGGTGGAAGCGGTGAAAAGTATGCGGTTTCAGCCAGATGTGGATATGGATGGCCC
CACGGATCTGTATGAACACACGGACGAGAGCACTAGTACACGCTTACTACCCGAGTACAGTCACCTGTTTGCACACTCAGCCTCTTCGAGCTTCTTCGCT
TACATTCCAATTTACTTCTGGAAACAAGTGGTTCTGAGACGAATCGATATGCAGCCCTCAAGAATGTTCGATCACCACGCCGTTTACAATGGAAGAGCTG
ATGATCTTCCTCGGCATCATGCTTTATCTGACCCTCACTGACAAGGGGGAGTACTCTAACTACTGGGGGCCACAGACTGAAGATGCGATTTTTGGTGGTG
CATCTACCAGCTTGGACAATGTGATGAGTCTAAATAGATTCAAGTTGCTTCGCCGCTGTTTGAGCTTTCGCGCTGATCCGGGATCGGCTGTGGAACGAGA
CCCAGCAGCCCGAATTAGGCCCCTATTGAATTTGCTCAAATGCACTGGTGGTCGCTATGTTGAGCCTGGCCGTGACTTGGCTCTTGACGAAGCCAGTATC
GCATGCCGGTCCCGCCATGGACGACATCTTATCGTGTTCAATCCCCAAAAGCCTGGCGGCAAGTATCATTTTCGTATGTACGTGCTGTGCTGCTCGACCA
CGTGGATCGCTTTGAACTATCGCCTCCACTGCAATAATAGTGATATCGCGGACCGCCTGCAAAACGTGGTGAGACTAGAAGAGGTGCAGCAGCTTCGTGA
GGAGCTCGAGGATGTCAAACAAGTGCGTAAGCATGTTCTAGAGGTCGTGAGGCCCTACTTTTACTCTCGACGAATCATCAATATGGACAACTATTACACA
AGCGTCCAGTTGCTGTTGGATTTGCGTTTGAAGGGGTTGTATGGGCGGGGAACTGTTCGGGGAAGGAGTAAGCACTATCCGAAGCACACTATTCTCCAGA
AGGAGCACTCAACAAGGGGTGACTATCAGCAGTCTGTCTCCCTGGAGCACAACTTGCTCGGTGCGTCGTGGTGCGATGGCAATACCGTGATGATGGTTAC
CAATGCTGATGCATCTACTGCCGCGACAGTCACGCGGCGGGTTGGTAAAAATACTCATGAGTTTCCTGCTCCGAGCTGTATCCTGCAATACAATCGACGC
ATGCAAGGTGTTGATCGTTTGGATCAGATACGAGCTAGATTTTCACTAGCTGATGGTCATTCGTTCAAAAAATGGCATAAAAAATTGGCTTTGGCAATAG
TGGATATTGCACGGTCCAACGCGTACCTGACTCGACGGATGGCAATCGACACTTCCAGAGATCGAGATCCCCACAGGACGTTTGTCACTGAATTAGTATC
TGAGCTAATTTCTGGCAGGTGGCAAGAAGCCCCGAGCGATAGTCAAATGGCGTTTGGAAGCGGTGTTGCTGATGAAACCGCAGCAGTGGATGCAACTGGT
ATAACTCCTAAAGTGTACACTTCGCCAAACCCGCACAGCGCCCTGAAGCGATGTCAGTCTATGCCTTCGAAACAAATGTTCAAGGACAGTGGGCGGAAAC
GTCGGCAGTGCATTGTGTGTCGCTACGAGGGCAGATATCCTACAGAGGTGACGGATTATTGCCTCACGCACACTGTTTGTCTTTGTAGCACTGTGCATGG
ATACATCGAGAGTCCGTACACGTGCCCACAGAGCACTTGAACTTGTTGGGATAAGTTTCACAGATTCTATCTCCCAAATGGCCTCTTCAGTGACAATGGA
AATGTCAACAGGTCATCGCATCTGGCTAAGTTGAAGGCAAGTAGCGCCGCGAGACCCGTCGATAAAGTTCTCCCTATCCCCGAAAGCGATAGTGTCGTGC
TCTCTTATGAGACCCAGAGCGACAGTTCTGTACTCTCTGTCGACGAAACCGACCTACTTCTCAGTAGTGATTGTGCAGAGTTGCTCAGCGAAGATTCAGC
GAGTCAAGACAGCAGAGATGCGCGACAGATATTCCAATGATTCGCATTCTGTAGGCAAAGAAGAGGGTATTTATCTTGATTAAAGTATGCTAATGCCTTC
AGAGCAACATGACCGAATATATATCGAATAAACTATGGTCAATGTCTTTAGCATTATCAACAAGTGTTTCTCGTCCCAAATAACACAGTGGCAGCGTTGC
ACCCACGGCCATCGCCGCGGGATCTGTTCGGCCATCATCGCCAGCGTCAGCTCCAACTGCAGCTCAGTGCCCGCGACGTTCCTGTGGTAGGCCAACTGCG
CCGTTCTGGGCATCACCACGGCCTTGACAGCCGCCGCCAGCCGCGTTGTGTCCGTCGTTCCCTCCTTCACCAAGTCCATTCGCGCTGAGACTGCGGCCGC
CCAGTCCATCCAAGCTGCAGCTGTCGTGCGCCAAGTCCTTTCGCGTCGCGCCCGCGCTGTGGACGCCGTAAACATGTGCGCAAAGTCCAGCACACGCTGT
TGCCGCCCGGCACCAAGTTCAGCGTCCCGTGGCCGACGTTCCTGATATGTTGCCGCCGTGCACGCAGCTCGGAGTGCCGTGGCCACCATGCCCGTGTTCG
CTTAGTCCTGTTGAGCTGCGCTCGCAGTCGCCAAGTCCCGTCGCCGCCCGCTGTCGTCTAATCCAGCCGTGCCCGTGCGCGCCATATCCAAGCTGTCGTT
CACAAAGTCCAGCGCGCCGTAGTTGCCGTGCCCGCTTGCACCAAGTCCAGTTGCGCCTTGACCGCGATGTTGCTGCCGTGTACGATGTCCAGCGCGCCAT
GGCCGCTGTGAATGCGTGCGTCAAGTCCAGTCGCGCAAGTCCGTTGCAGGCTTTTAGCATTGTTTGTATATGTATATTGGAAGTGGTAGTGCCTTCCAAC
TGCCGCGGCCGTAAGTAGTTGCCGTCAATTTCCATCTCGCGCAAAAGCTGTTGCGGCATGATTCACGGTGGCGGGGGCAATACTTAGACGTGGATACTAT
CAGTCGGGCTCTTGGCATGCGAGTAAGCTCTTGTTGCACCACGAGCTTGGCGGCTTCATCAAACAGGAAATCATTAAGGAAAATGATGGTTGCATCGTGA
AATGGTGCGGACGACCACAGCGGCGTATCGCGTACGTCCCCAGACTTCAGACTTACCTTGTGCAGAAGCACTAGTCGCGACGCACATGATCGCACGCACT
CATACCCCCTGCGAGCAATATCCACCCTTTTCTCGATCCCCAAACACTGTCTAGCTTTTGTCTGCAACGCGAACTGTGCAGCAACATTTCCCAAACCAGC
GCCTATGTCTAGAAAGACATCATCTGGCTTCACCGCTCCAATACTTCGAATGATACCCGACACCGCAGCAAGAATCATCTCCCCGGCATTTCCGTCAGTT
TTACCTGCCTCCTGGCGCACATCAGCAGCCGAAACAGCTCCAAAAATCTCACGGATGGCTCTTTCAGCCTGGCTTGGGGACAGGAGGCAAAACTTGTTCA
CATATTGAGGCGTTGGCGAACATGTGGAAAAAAAACAGGTAGGGAAACGCCCGAGGTCGTTACTGTAGGTACGCTTTAGAGCGCGCAATCTCATCTTGAG
TTGTGCTGCCGGACGCTTCCTGCGCATCTTGAGCTCGATGTCCTGCCAGACAACGCGCTTGCCGTGGGACTCATACTCGAGGGCACGAACAACGAGCTTC
TTGTCTTCTGCGTCGGAAAAACTTGTGCGCATCTGAAACTGACGATAAATGAAAGAGTGAAGGCGAGCATCTCACCTCAGTATTGTATGAGATAGGTTTG
GACGCCCGAACTGGTGGCGCAGCATCACGCGGGTCCAGGATAGAATTTGGGATGGGTCCACCTCGTTTCCACCACCTGTACCCACCATTTCCTCATTGCG
TTTCATGTGAATGACCGCAAAACCACAAAAATCACGGGATATGGGGTGAAAACAGGGCGCTTTCGTGCAAAATTAGCATTTAAATTTTGATAGTCGGCCT
CAAATCCTCGAGTGGGAACACCTAACCCACCCGCATCTAAAGATCTGATTGGCTTACACAAAACACGGTCTACTGAAACCCTGGTAAAAGCTAAAAGGAA
GCAAAATGCTTCCTTTTAGGGGGTCCATTTTCACCTACTTTTGTGAAAGTGCTTAAAGGTAGCAAAATGCCTCCTTTTACCACGAAAGGGTTAAGAAATT
GGTAGCAAACGCGACAACTTAGAAAGGTTGCGGACTACCCAAGTCATCAGCAGGTATCTCTTTGAACGAAAATGTATGTCATCTGATGCATCGTTCCATC
GAGGAAATGCATTTTAGAAAACTATCTCGTTCCGCAGTAAGTGAAAAATGGTTTGGCGCCTTGGGTGCTGCTTCTATTGTGCGCGTTTCAATCAAGCCGA
GTATTTCATCGATGGGTGATACAATATACCGCTAAATAATAGTACCTCCAGCCATCAAAACAGGTGGAGAGACTTCGGTACAAATAGGTCGTGAGGTCAA
CAAAGATAGCATCCAGTGCACAGACATCATTGTTCAGTGTCTCAGCAGGCGATCCCCAGTTGCCGACTCAACTACAGTGCCAACTACATGTAGAAGTACT
GCACATCAGACCAAGACCTCGTGAGCTATTCAGCAATGTCCGCCCAAGAGAAGAGAGGCTCGACTACATCTTGCAACATCATCTACTCACTAGTACCAGC
CCAGCCGCTTCCAGTCGTTGACCTATCCAAGACGTTTCGAGGCCGGCTTATTCCTGGCAGCGTTCACACATACATCCGTCGCCGATACTACCAGTACTAC
CGAGAAATCTTGTTTTGCGCAGCAGTATCCTACTGCATCAACGCCATTGTGCCCATGGTCAAGGCTCCAGTGGGCTGCGTGATGTCGATATTGGCCGTTC
TCTTATGGCTCCCTATGGGGTTGGGAAGTGTGACGACACTGAGATACGATATCGTGCGCTTGGTGTGTCGAACGTTCGACTTCTGGTTCTTCTCCGTTGT
CACAAGCGTGATTGTAGTTACGATGTCGATGTACTTTGGAGATTTGCGCTCGGTCCGGACGGTGATCGACTGGATAGGATATCATCACGTCATTTGTGTT
GATGCTCATGTTCTGGGCCTCCGCAGTCTCACTTGCTTTCTGATCGCGGCGATTTTTTCGGTGTTCGTTGCACTTGCTTGGATAATGCTTGGGCACGTGG
ATAGTGGCTCAATCTTTTCAATTCTCAAATATCAAACCAGACATGGCAATTTTGAGCTCTCGGGGCTGGATGTGATCGGAAACGGACTGGTATCACTTGG
ATTTCTGCTTGCAAAAATTGTGCTTCGGAGACGCAAAGTTTTGCGTTCTCATCCCAAAAGACCAGCTATCGTTGAATGTGTCATTTATCGCGCCATACTA
AAGCTGCAACCAGTGCAAGCACCAGCAGAATCGTCCGCGTGGGAAACGAATGATTCCATGTTCAAAGCAAAGATGTCATCCTTGAGAGACACTGATATCG
TGCAACATTTAATGTTTGTCAACTTTTCTCAGACCTTCGCCGCGAGTAACACGCTGCTTCCTTGGCTAACGGCAAACAAACGTCGCTTTCCGCTGTGGTC
AATGGTTGTGTTGTATTCAGTTGGAGCAGCTGGACTGATACTTTCTCACGTCGCCCTTGCACACGAGTTTAATGAATCACATGATGATCCTACAGCACAC
GAAGATTTTATATTGATGGTATCATCAAGCGCACTGCTGTGCACAGGCGTGTTCACATCTCTATTTGCTGGATTTTACCAGCCCCAACTACTCAGTTGCT
CTTTACTTCGTTTGACTTCGTGTTTTACTCCTTTCAAGTCACGTCTGCAAGTATCTCTGTGAGCGTCTTGTACAGCTGGGACGTCGCGCACAGCTTGATG
GTGATTTCGTGGTGGCTTTGGGCACACTGGGTATTCACCTTAGACGCGTTAACTCCAGTCATGCGGGAAATGCTTCGATTTCGTAGTTGGTTTGCCGCAA
CCATATTATGCTTATTGCTCGCTGACCACATCGCAATCATATGCCGGATCTTCTTCGCAGGAGATTTACGACTCCAAGACTCGGTCATCTTTGAGGGCAC
TATTTGGGGTCAGCAACTAAGCTTTCGTGTGATACCTTTTTACGTCAGTCGATCGTTCACATTGATGTTGTGGTTCTCTCGCTTAGTATACCGGCTTGGC
TCAGCATCAAACGACGATGTCACTATTCTTCGTGGAACTGTCTGCTACGACAACGTTTTCGCGAAGGGAAGACGAAAATTTTCGCAGATTGCTCATATTG
TCGAAGCCAAGACATCAGCAGCAGCTTTCTCTCGACGAGCTAGAGTATCGCCTGCTATGTCGTTCCACCAAGATCCAAGCCTAATGTGACACCCAACATA
TTTCTGCATGTAGGATGTCCAGTTAATCACTTCGATCTGTCATCAAATTGCCAATACGGCGATCCGGATACTACAAAGCGACTGCATAACCAGGTGACAC
CTTATCATGCACGATAGTCCGCAAAATCTCAGATGTGTCCGAGTTGATACCACCACTTGATCAATCCACCAAGGTCGGTTTCAACATAACGGTGCATGTG
AGGGGTTCAAAAGTATCAGGTTGCTCATCACTCTCCCTCGACCATTCTCTCTGCCCTCATAATATCCGCTAGCACTGTCAAATCGGCAAACCCATCAACA
AAGTGCACGTGAACAGGAATATTTAGGTTGAGCCTTGGTTTGTTGCCCTGCAAGAGAGTTCTCATTGCTGTTATTTGTGCGAAATAGTGCACGCATGCTC
TACTGTGTTTCTCTTGGTGGTGCAAACAAACAAAAAATTGGAGGATATCTTCAGTTTACCGTCGCGTGCGGCACTCTTCTTCGGCACACCACTGCTCGTC
CTTGATTAACATATTGAGGTGCCTGTACCATCCACGCCTCGCAGCATTCCGATCCAGTGTCCCTCGTACATTTCATCCCCTTCGTGACCCAATGGCACCG
CACAATGCTTCTCGAATAAGTATCTCCATCCTTTGTAATCCATGTCTGCGACCGCAGTCAGTAGAGCCAAGTCCTCGCGAGCAAGTTCGAATGTATCTGG
CCCATCATAAAACTCGAAGCGTTCTTCGACAGTTGCCCGGACTGGCACAAGTGCTTGGAGGTAACGTCTCGGGTAATCACACATCGGGCGGGTTTGTGTT
TGAGTGCGGTACACCACGGCACCATGAAGCCCCACCTCTAATCTAGATCAGTATCAAGAGCAGCACTACTGCGTGTCATCGTTGGGTTATGCAGGGCGCG
ATAGTTGACTTGAAGCAAATTCTCAGCAGCGAGGTCGGCGGTTTGGTTACATTTTTATTGGAGCAACCGTTCTGGTAGCGAGGAAGCCCGTGGTGTTCAT
GCCCTTCTCCATGTATTTAAGTACTTCTGTCGAATTGCGGGTTTGTGCCCGCGTTTGATTATGGCGTCAAAAGCAGTGCTATAACGATGCTTGTTCCGAG
CAAAGGCGATAGCGCTCAGGAGGGCCCCTCCTGAGCCCTCTGGACAATAGCACAAAGGCGTGATAAACCACGAGAGCGAGTTAATCATGAGACCGAATCA
CATCCAGTGGCAAAACAGGAATCGTGGTCGAGGTTATCAACGCTAACCGCTCTGAATAATCAATAGCCAGTCGCACCGGATACTCGAAATGAATTTGCTG
ACACTAGTTTAACGAATAAATCATGGCCTTGTACGCCGCCGTTTACTCTTCTGACTGTCCCAGTTCTTCCATTCTGATGCGTGCGTACCCATTTCCTTAA
CCAATTGCTTCCGAATTCGGAAAGCCCGTTTAGATTCATCGATCACGACTTCGATGGAGCGAGCGCGCAACTTGGCATTCTCAGTGTGAATACTCTGGTA
CACTTCGTGAGGCACCGATACTTTAGCTTGCCGCAACAGCGATACAAGGTCCCAAAAAACTGATTGGTCATCCTTATTCACAAGCGTCAAAACATTTCCG
GTCGAATCATCTCCACGCCCGATACGCCCAACGAGGTGAACGTAGTCTGACACTTTCTTGGGAAAATCATAGATCACAACATTCTGAACGTGCAGCAGAT
CCATTCCACGGCTCAGCACGTTTGTAGACACGAGGACAGGGGTCTCTAGATTAATAAAGGCCTCCAGCAGATGAAGTCTTTCGCTTTGAGTTTTATCTGC
ATGAATCGCTGCTGCACCAATTTGACAGCGTTTTTCAATGGCTTCAGCCAGCATGCTCGCGCCAAGTTTCGATCCGACAAAGACAATCTACAACGCCAGC
AACACAAAAAGTATCAGCCACCCGTCAATGATGTCAGCTAGCTTGAAATTCCATAAGAGTCAATGCAATCACCTCACCCACCGTTGACTCTTCGTATTTC
CCTTTCAAGAACTCAAACAACTCACTCTTTTTCACCTTGTCGTCCGACCATCGAACCTGTTGTTTAACACGAGGGTTGAGTGCGAAACTCGGTGTCCCAG
TTGTCTTCGAATCACTGCGACGAACGTCGACGCGAATATAATTTTGCTGGCTTTGAACTTGCAAGATTTGCCGCACCATTTCTTCTACCTCGCCAGCGAC
GGTGGCGCTGAAAAACAGCATCTGGACGCTCTTTTTCCCAGCTAATGCTACCAATAAAGCCACGATTTGAGAAATCTGTGGACGAAAGCCAGCGTCCAGC
ATAATGTCCACTTCATCAACAATACACATGCGAATAGCTGCCAGGATAGCATCACCGCCACTGTAGTTCATGAAAATATCGAGGAAGCGCCCCGGTGTCG
CCACAATAAGCTGAACTCCACCTTGTAGTCGATAGCGCTGGGTGGGGACAGGGAATCCCCCACCAATAGCGCCGTCTTCATGTCAGCTATGCCTCTCACC
AGCAGCTTTGCCACCGTCTCAATCTGAATTGCCAGTTCTCGCACAGGAGCCACA