Description :
From Genome Similarity Track
Location :
scaffold_6:11085- 14124
Transcript NameFunction/comments
Pl_112744hypothetical protein PHYSODRAFT_293759
Pl_112745hypothetical protein PHYSODRAFT_476353
Pl_112746hypothetical protein PHYSODRAFT_321832

Sequence
3039 bases(100 bases per row)
ATCCACAAGACTTGCCATCTTTTCATTCTCCAGTTGCATCAAAGCTCGTTGCACGCGCAGCTCCTCTTTCTCACGCCGTACTTCATCGCGTTCTCGTCGG
AGTTCCTCACGTTCGCGGCGAATTTCTGCCAGGAGTAAGCGATACTCGTCAATAATACGACTCTGTTGCTCCACCTGTTGATGAGATGCTTGAGCATCAT
TATCCTGGGAATATAGCTGCCTTCCAGCTATTCCACCACTCAGCATGTTACGATCAAACATGTCGTGGCTGTCATCTCTACTATTCCGTCCAATACCTTG
TGGCATCTGAATTCGCGACGGAGCCGGAGGAGGTAACAACGCTTCTGTCGCTCCTAGGTTTCCATAGTGACGGTCTCTTTGATACGGCATTGCTTTATCA
TCCTCCTCCCGCGAGTCAGTAAATGCAAAATTATGGTGGTTGCTCGTCGGCTGCAAGTCGCTCCTCTGTCTATTCGTCAAGTCTGGAGGTGACGGCATCG
CATGATACGGAGCGTTTGTCTCCGTCCTGTTTTCACTTGATTCAGCATTCACAGCAGGTGAAAAGTGTCCCAGCCGTCGTTGTGCTCGTAGTTGCTGCTC
TCGAAGGTATCGCACCTCTTCTTTAGCTGCTTCTTGCTCACTGCGTTTTCGTTCAGCCTCTTCCTGCTCCTTCAGCCGTGCTTTTTCCTGCACCTGCTCG
TCCAAAATCCTCTTCCACTGCATCTGCTGCGCGCGTTCCCGTAGTCTCTGACTTGTTTCACTCTCATCAGTCACCTTAAAGCGTGGGTGGGACGACGACA
CGCTGTTTGCTTCACCTGTAGCTGCACCTCTGTCTTGTCGCTGCTCGTCGTGAAGATCCACGCTCTGTGTAAACTTCCAGGGCGACTGGGAGGCCGTTGG
CATGTCCAAATGGCCGCCTTCGACCAGCCACTTGGATGGAGAGCGCTCGGTTGGCGCAAGTTTGCGCTCCAATTCCTCGCGCTCCATCTGCTCCTGGTGC
TGACGCGCTCGGCGCAATGCGATCTGGTGGTCTAATTCCCGTGCATACGCTTCTCGTCGACGTTGAATCTCGCGTGGATCGTCGTCATGGAGTCCAGCCT
CGGAAGCCCACATCGAAGCTGCTCGCGATTGTGTTTGAACGGTTTTAGAGGGAAGCGATTTGATTGGCGCAGAAAATCACGAAACGAATTTTGAAACGAA
TGTTTTTCAACTTTGACAGTTGTGAGTTAATAGTGATCTGATGGAATGGAAGTTGGACGGATATGATGCACATGTACGTCGTCTGGGCTAGACTCTGGCT
TGTTAGAAGTTCAACGAGTTGCCGAAAAGACAGGAATCAGCATATTCACGTCGTAAGTCGGCTATCAGCTTCTCCACTTGAAGATCAGAGCGTCGACACT
CCGACTGCAAGAGTTGGAACCGCAATGACACGTCGCTCTGGAATCGCTTCAGTCGTTTACGCTCCTTCTTCGCTTCATCTCGTCGTGGTCGATGGTGACT
GCTGCTTCGACGACGGTTGTGGCGACTGTAGTCACTTTCACTGTCACTGGCACTTCCGCAGCTCTCATAATCTTCTTTCTCTTGAGGCCCACGCAGCATT
TTCTGGATACGAAGTCGCTCTTTCCTGCGTCGCCTGCACTGCTCCAAAGTGCGTACAAGTACCGCGTGCTCTCGCTGCAAACTGTGCAAACGATCCTGCC
CTCGTCGAAATGTCTCCTCCTCGCTCTTCAGCCACTGTTTCTTGCGCTCCGCCTCAGCGTAGAGCTCCGCCAGCATCTCGTTGACATCTCGGTCGTCCGC
GCCATTTGTCTCTCCCCTTTGTGTCAAGCGCAACGTCTGGTTGACGCTTCTATTGCTCGCTCGGGCACTTGACACTTGTTCTTGTGTGCGCACTCGGAAG
ACGACCGACTTTTCAGTGGTGCGCACCACGCGACGAGGTCCTCGCTCCACGGATTGCACTGAAGACCAGGTAGGGCTGTCGCTGTGGTCCCGCGAGTGGG
CGCTTGACGACGAGGAAATGGCGTCCTCGCTCATCACTCAACGATACGGTCAAAAGTGATGTGCGAGTCTTCACTACTGATACTTTCTAAACAAATATAT
GGCATTTGGACCACCTAAGTGAAATCGTAATTATTGCGACTCATGAGAAAGATTACCCTCGAAATAATGATATGGCTGCGTGCTAACGGCTTTGATAAAG
TGCAACTTGCATCAAACGTCATGTGATTGTATCTACTACACTTCTAATGCTGCGAGCAGTGCTCAGTGCTGAGCGCAGCAGGGTCTGCTGATCGGCAACG
CAATTTATAGTTCGCCATGCGGGACAGGTTTGCTGGTGGGGATCGGTGAGATCATCGGTGAGAAAATGGGCCGCGAGCTGTGAATCAACGCTGTTGAGTG
TGCACCGCCTGCAGAGACCTGGCGAACGGGGATCGGGCCGAGATCCAAACGTGTGGGCACTGACAATGGTTTCATGTCCGTCAAACCCAGTCGTCCGTGG
CTGTAGGAAAACAATACGGCAAACGAAGTTAGTCCTTGTTCGCAAAGAAAAATAAATGCACGAAACGTACTCTGGTCGTCCTGCAACGTAGGCAACACCA
TCGCTCGTGACAAACAAAGTGTGAGAGCCACCGCACGCAGCTTGAATCACTGTCTTCCCCTTCAGTGCCTTCACCTGAAGGTCATAAAAGCTCATGATGT
TAGTATTCTACAAGCATTTCAAAAGAATATACAACTCCATACCAAGTGCGGTCGTGTTCGACTCTTTGTATCACCAAGCCCCAATCGACCATATTCACCC
CGGCCGAAAGCGTAGCAGTCTCCTGACTTCGTTACCACCATTGTATGCCAGCCACCGCATGAAACGCGCCTGTGCAAGTCAAGTCATTGTCATACGGTTT
GCAACAAAACTCCAATACACAAGCAGCAAAACGACAAGCAACGTACAGAGCTGGGATTTCGTCGAAGAATGCTACGCGCTTGGGGGTCTGCTGGTCAGAC
GCCTGACCAACACCGAGCATGCCGTAGTCCTCTTTTCCC