Description :
From Genome Similarity Track
Location :
Scaffold_485:11085- 12604
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_485-fgenesh-gene-0.3DEAD/DEAH box RNA helicase

Sequence
1519 bases(100 bases per row)
ACGTCCGAAAACGACAGCACCGGGCGGTACAGGCAGTTGTCGCCGCTGATGGTCATCTCGTTCTCCTGGTGGAACGCCGAGACCTCGTCATTCGTCATCT
TGGCCGTCGCCGTGCTCTCGACGTAGAAGGACTTCTTGAAGCTGCCGTCCGACGCCGGCGGCTGCTGGTACGGACCGTTCGAGAAGTCAGCGGCGGGAGC
GTCGCCATTCGCCTGCTTCTGCTTCTTGTCCTTCTTCTTGTCCTTCTTGTGGTGCTTCTTCACGGGCTCCTCGCTCGTCGTCGACTCGTCTTCCACCGGG
TCGGCGTTCTCGTCGCGAGCGCGCTTCTTGGCCTCCTTGCGAGCCTTCTTAGCCGCCTTGCGAGCACGCTCATCGTCCTGCTCAGCCGGCGCCGCCGCCG
CCTTGTCCTGCTCCGCCTTGCGCGCGGCCTTCTTCAGCTTCTTCTCCGCCTTGCGCTGCGCCTTGGCCGCAGCCGCATCCACCACGCTGCCGCTCATGGT
TGGTCGAGCTTTGGATGGCCTTTCAAAGTCTGGCTGCTTTGACCCAGGACGAGCTCAAGCACAACCAATCAGCGCGGTTTACTATCTGCACGTCGCATCT
CATTCTATCTGCACGTCAGCGAATATCGAAGTGCCTGCGAGTTCTTATAACCTGGCGGAACGCAAGGTTTTGACTTTCACAGTGATGAGGTGTTTCCCGA
AACACGGTGAGGTTTTTCCTCGCGGGTTTTCAAAAACGAAAGCCCAGCGGCCGGTCGGTATCGCGCGCGCGCGCAAAAGCGCGGGCCGGAGAACGCGAAG
CGGACGGCACACAGCGCCATGGCGGACGGCGGCAGGAGCCCCGAGGCCCGGCGCAGGGGGACCATCACGCCCGAGATGCAGCGCGAGATGATGGGCGAGC
TGGGCGGCCGCTCGCTCGAGGGTGGCAGCGCCAGCAAGTCACGAGGTAACGCTCGCTCACGACTCTGCTCTGTCGAGGCTGGCTGGCTTGGTGATGGAGA
GAACGCTAACGGATTCGATGGGGACTGTGTAGCTGGCGCGACTCCCCCGTCGACGGAGGTTCCAACGCCCGACACGTTCGTCAACCGCAAAGGCAAAGGT
GCGGCTGCGACGTCGACGGCTGACAGCAGTCTGGATGCAACGGCTGACGAGCTGGAGGCTGCCGCGGCGGTCGCGCTAGGCGGCGCAAAGGGCAGGACGG
GTCGTTCACCTGGCGACGACAAGAAGCAGCGGGAGACGCTGTCGCCGTCCAAGATGCAGATGCTCATCCAGCAGGAAGCTGCGGACGACGACGATGCCGT
GCGTCGGAATGACACTGCGTCGCCCAGGACGCTCGCGAGGCTCATCGACGAGATGTCGGTTGGAGTTACTGCTGGGAGCGGTGCGAGAGGCAGCAAGCAG
TCGGTGGTGCTCAAATCGGCCGAGAAGAGTCGAAAGCGGGAGCAGGATCACCTAGCACAATCGATCGAGTACCTGGAGGCGTCCAGACTGGCGCTATTGG
ACAGCCCAGCTGCTTCGAC