Description :
From Genome Similarity Track
Location :
Scaffold_155:110842- 112420
Transcript NameFunction/comments
Physo_143877hypothetical protein

Sequence
1578 bases(100 bases per row)
GCTTGGCCGGCGATCGTTTCTCCTCTCGATCAACCTCGATCCCGCTATAGGAAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGAAAGGCAACT
ACAGGCCTTGGATCAACTCCAGGCCGACCGATCGAAGCGAAGAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGATTACCGCGCTGCTCCACA
AACTATCCCCGCGTCACGCCAAGACATTCGATCTTCATTAAGTGCTGCATCTTCGGAGCCCCGAGAGAGCAGATCCAGCCCGCCGACGGGTACACAAGGT
GAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGACCCCTCCGTTAGTCGGTGTCTGGGCGCTGGCGGGAAGCTCGATCAGGCCTTAACCTTAACCAAA
TTTTGGCCGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTCGTGGGGACTCCGGATTTCACCGTGAGTCCGTAGAAGATGCGCATGTGAAGAAA
GAACCAGGGGAAGAGGCGTCGTCGGATATCGGATCGACGAAGACGCTGCTGAACAAAACGAGATCCGCGGATCGACAGAGTGCTCGGAGGACCTCTGTCG
ACGGAATCGAGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCCCAGGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACCGAGA
TTCACTAACAAAACAAACTAAGGCGGGATCGGACCGATACGCGTTCGCCGACTCGCCGATCAGGCTCGATCCGGACTACCTGGGCGCGATCGCGGACAAG
GACCAGATCGTGAGGAAGAAGCTGAGAGCGCCAGGCCTGGACGACGAACATCCCAGACCGTCGGCGCTCGACTGGTCCGAGGCTGACCTGGATCGTCAGT
ATCACTGAAGAACTGCGAGACTTCTTGCGTCAAGATCCCGTCATGGTGATCTTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATCTCGGCCCCCC
GAGTGACGGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCTGTTGAAGGAAGCCGACTTCGTGGCTGGCGCCTTTGAAGCGAATGATCTTTTCGA
TCAGGATCTCGATGTGATCCAGATAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACGTGATCGCGGACAGTCCAGACCCGAAGGTGCTA
GATCTAGTGTCGCCAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCCCTGGGTACCGATCGTCGTCTCCTTATGTCTCCGCAGCGGAACACGTATCGGATA
CGTCGTCTGAACGTCAACGGATGTCCCTCGGCCCTTCAGGATCTGCGATGTTGGACGCACGATCACGGAGTCAACGTCAGGAACGCATGCGATCAGGACC
TCGGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAGTGCTACCGGATCAGATGAGTCGAATGGCAAACTGGAGTCTTACTTTCAGGCTGCGATGGCT
CGATTTCTGAAGGAACAACAGGCCACCTACTCCAGTGGTCGACGACAACGTTGGATCGCGGGACGTGGAGATGGAATC