Description :
From Genome Similarity Track
Location :
Scaffold_122:110810- 111921
Transcript NameFunction/comments
g2502.t1hypothetical protein

Sequence
1111 bases(100 bases per row)
TTGGCTCGGGGGGGTCCAGAGAGCTACCAGTACTTGAAGGCTAGTGGATGCTACGATGTCGACGACGTGAACGACGCGCAGGAATTTGACGAGACCATGG
CAGCCATGCAGCACGTAGGGATCAAGAGAAAACAGATTGAACTCGTGATACAGACGCTGGCGGCCGTGCTGCATATTGGCAACGTACACTTCCAGCCAGA
GACCGTGGGGGATGCGGAAGGATCGTCCGTGCGCGACCGCGAGAGTCTGCAGATTGCGTGTGACCTACTGGGACTGGACGCTGCCCGTCTGGAACACGCT
CTGTGTTACAAGCTGTTGCAGACGATGGCGCCTGGAGGCAAAGTCGAGTCATACGAGGTGCCGCAGAACACGAGTCAGGCGAAGTCTCAGCGCGACTCCA
TCGCCAAGGCTGTTTATGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCACGCGCTGGACATTGAAAAGAAGGCGGAGAAGCATGGCGAGATCCT
GGAGATCGACGATATGACCACGATTGGTATCCTGGATATCTATGGTTTTGAAATCTTTGACAAGAACGGGTTCGAGCAGTTCTGCATCAATTACGTCAAC
GAAAAGCTGCAGCAGATTTTCATCGAGCTCACGCTGAAGAGTGAGCAGGAGGAATACGCTCGCGAAGGTATCGCTTGGGCCCCGATCCCGTTCTTCAACA
ACAAGGTCGTGTGCGATTTGATCGAGGCGAGGCGCCCTACGCCTGGTATTTTCCTCATTCTTGATGACACAGTCAAGACGATGCACTCTCGCCAGGGAGA
CAGCGTTGATGCTAATTTCCTGGAGAAGGTGGCGGGAATCCACGGATCGCACCCGCATTTCTCGAAACGTGGTAAAACGTTTGAGATCAAGCACTATGCA
GGTGATGTGCAGTACAACATCGATGGCTTTGGAGACTCGAATAAGGACTTTTTGAGCAAGGATATCGCTCTCATCATTAGTGAAACTTCCAACAAGCTCA
TGCGGTATATCTTCCCGGAAGAGATCGACCTCAACGACAAACGCATGGCCAAAACGGCCGGATACAAAATTCGTACGCAGTGCGAGGCCCTCGTGGCCGC
ACTCATGGATT