Description :
From Genome Similarity Track
Location :
scaffold_1485:1108- 2650
Transcript NameFunction/comments
Pl_100626hypothetical protein PHYSODRAFT_333561

Sequence
1542 bases(100 bases per row)
GTTTATTGCCTCAAAGACTGGGCAAGATTACATTCACGCCATGTTTGGGTAGTCGTAGCAAACGGCACACACCAGGATGTTGCATAACATCGTGTTGAGT
CCATCTCAGGAATTGTTACTGCACGAGGTCGAAGGTAATCCCGCGGAGCAGAAGCAACAAGCCTAACGCGCAAAGGCTGAGCAACACAGCACTTTGTATA
GAGAATGTGTTCGATTAGTGGGGTGACACCAGTGGTGTCAAAGGTCTTGACTGGATGAGCTAGAGACCTCGTGGTGAAATGATCTCCTTGACCCCAACGT
TAATCAGCGTGCTAGTGGTCTTCAATTTACCGATTTCTTACAAGTGACGCCTCTTTTCCGTCTACCATGGTGAACTGGTCGAACTTTCTAGCGGTCTTAG
CTGTTTTGAGCACTGTTGATGGATCAGTCGAACGGTCCACTACAGCTTTAAGGGAATCAAGCGCTACAAACAGCACAAATGAGTCAACCACTTCGCTTTC
ACGGACACAAGATTCAACGATTATATTATCCTCATTACACAGGGGTCTTCGAATCGAACCCCACGTCACGACAATCGACACGGTCGAGTCTACCTACCGG
AATTGGGTCGGCCCTACCATCGGCCAACCGGATCGTGGTGATTCTGCCTGTTATCGGAGAGCACACATCATGAATAAGTGCCCCATTGGCTTTGACTACA
AGTGGAAGACGTGCTGGACGCAGTGTCCGCTCTCGTATCCTGTGGAGTGCGGGATGGAATGTATTCGCCAAAATGACAACTGCGCACTCGAAGTCTACGC
TAAGACAGTCAACGTAGTTCAGACAGCAATATCGCTGGCTACAATGGGTCTGTTTGGTGAGCTCACATTAGCGGTGAAGGGCGTCGTTGCAGGTGCCAAG
TGCATCCGATCCATGATCGGCACAATTAAGATGCTCATCAACTACATTCGTGGTCTTAAAGTGTACGACCCCCAAATTCCCTACGATCGAATCATGGCTC
TGTTGTACCAAACGAGTTACATTACAATTGATTTCCCGGTCACCATCGCGATGTGCTTGGGTCACTCGTATCCCGAAGTTCTAGATCCAGCAAGTTGGAT
GGTAGACACAATTCAATTGCAACTTGGAGAGATCCTTGACAATGGCGACAGCATCATCCGAGGTTGGGACCGGTTCAAAGCTTTTCTTCATCGAGTAAAC
TTTACTCAACCTTTGTCGGAGCTGAATGAGACTGATATCTCGTCACTCAAGACTGGTTTAGCATCAAATTCGACGTGCGGATACGAGCTGAAGCGGATCA
CAGATCGGACTTGGATGACCGTGGCTCAAATGAAGAGAATGAACCCCGGAATCACCCAAGACGAACTCCGTATTGCGATTTACGGATCGGATCTCATGGT
TCATGACATTCCGACAGTAACCAACAATTGCATGGAGCAGATGATTTCCGAGTCAACGGAGGCTACAGCTTATCAAACACGAGATACACTCCGCAAAACA
CTTGGGGTGATTGTGGACGATCTCATCGATAAAGGAACCAGT