Description :
From Genome Similarity Track
Location :
Scaffold_175:1108- 2268
Transcript NameFunction/comments
Phyta_totarag5070hypothetical protein PHYSODRAFT_337664

Sequence
1160 bases(100 bases per row)
TCAGGCACGATCCTTTACTCTTACTAGAAGTTCTCTTACTCGCATAgtgtcggagctcatggTAGAGCACGACATAGTAATCGCGGCTTTGATCCGTTGA
CGGATCCCAGTCCTGGGCCTCAGCCATGGCATCATCACTGATGCCGCTGTCCGCGTATAACGATCACCGGTTGGGCAGCACACTGGCGACCACCCGATCA
ACCATCTCAGATGCAATAGGCATCCACGGGACGCGCACTGTAGTGTCAGtgcgcgacgacgaaagATCTCCTGGTGCGGCGACGAAAGCTCTCCCGCTGC
GGCGAGCGCTGACACTCTGTCACTTCGCGAGCGCTTCGGACTGAGAACGCTCGAATCATCTTCATGAGGGCGGCATGACCCAGCGTGAGGGTCGCGCACA
ACGACAGCTGAGGACAAGGAGCCCTTTCGCTTTGAAGATGAgaccttctcgtcttccatcgTTTctctcgtcttcctctgaacTCGGTTAATAGTTCACA
GGAATACCGCAGTATCTGTCATcggaggctgctgaggaATCAGCAGAAACTGACTTAGGTTTCTCTGTCTAGAGGTGTCaccacgcttctgcttcagcat
aACGTGGTACCCAGAGACAGAGAGGTTACCCTCTGTCGTGGAGGGAGGCGGCGTGTTGGCTGGCTAGCTCATTGCGAAATGAGTTCGATTCTTTCCGAAG
TGTTGACGAGAAGATCAATACAGTTAATGACTGTCGGGACGGATACGTCTTTGGCTTGACTGGGGGATGGTGTAACGcggttacacgtacaagtggctac
atcacttgtaacctaacagaaatggcttctgttagaagttagNtttaggcggacgactggcccacatacatttagagatctaattggtagaaagcagcga
TTTTCTAACAATTAgtaggattctgccgaccacccgtcggcaaacccctattacatagtatgatatttaggaggtaattcgttacgaataagcaaacaaa
atacagttctcaatttcacctaaagtgttaattatcCACTTTACATGTTAATCTAGccttaattatacttgcaggatGTATGTTTATTAAAGCCAAGTGA
AAGAtacctacgcttcctcatacacgtgcgcacatGTGTGAGCTGAAGTATTGGTCTAAG