Description :
From Genome Similarity Track
Location :
Scaffold_126:110784- 113489
Sequence
2705 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACTATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGCAACACAAAGTCCCCCACTTTAA
ATATACTTAATTTTCCTCTTCCATGTTTGTCGGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGGACCCTGCTGACAACGCTCAGCT
TGGTATCCATAAAGGATTCCACTTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCAAGCCTCTCCTCCACTTAGAAT
AGAGGAGTCAGTGTCTCCTTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGTTATTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTT
GTTGAGCGCAAACTCAACAACTATAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGC
TCTGTCTGGCCGTCTGTCTGTGGATGATCCGCTGTGGACATCTGCAGACGAGTTCCCAGTAAAAGAAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCG
GGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAATAGTGACGGGAAC
TGGAGTAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTC
ATCGACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCTTAACGT
ACCGAGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCTAAGTGGCCGCTGGAGGGCGCGTCATG
CGCCTCCGCGAGGATGTCGAACTTTAGATCCTCGTCGTTGAGTACGACCGCTCGTGGAGGATCAGTTGGCTCCACCCGGTAATAGAGGAGGCCCTCCTTC
AACTCATATCGGTGGAGCCGTGAGCGCTGTCGCAACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCATAAGGAACTTGACGATAGGCGCGACAGCCT
CATCGTCCCGATACGCCATGCGTATCCGATCACATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGC
AAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGGAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTA
GTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCCCAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAG
CTCCTTGTCGTGGACAGGGTAGTTCCGCTCGGCGGCTTTGGGCTGCCTGGACTGGAACGAGTTGACTCGTTCGTGTCCAGCCGTGCCGGCCTGCAGCAAT
GCACATCCGATGGCGTAATCGGAGGCACCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCGCTTGGAGACTGGCCTTGA
TGCTGTCAAAAGCATCCTGGTGCTCTTGCTTCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGTTGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTG
TACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCCTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAG
CCCGAACGCCCACGTTGCTTACGAAGCAACCGAAAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCAT
TACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTTCCTCGACACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGT
ACGAAGGTACGCAAAAGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCA
TGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCT
CCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAGCCAGACGCCAC
TTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAA
TGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGA
GAGCT