Description :
From Genome Similarity Track
Location :
Scaffold_493:11078- 13211
Transcript NameFunction/comments
Phyke_g9833transmembrane protein, putative

Sequence
2133 bases(100 bases per row)
TCGGCCATTTGCTCCAGTGCTGCCTTCAAAGCTCTGTCAGGTACACGGTTGGGTGATGGCCCCGTGTTCATGCGCGCACTCGTCCAGGGCGACGAGGTCT
GCATCGAGTACCAGTTGGACTCGTCGGTGGCCAGTGATGCCACTTGGTTCGGTGTCGGACCCTCCCGGGGCTCAGGAATGGTCGGCAGTCCTGCTGCCAA
TGTCATGATGTTTTTCAAGTCGGATGGCAAACCGACGTCGTACCTCCTTGGGGGCtacaccagcagcgccatttCAGCGGAGAGTGACCAGACCGCCTTT
GTGGTTGGagagaccagcaccaccagtaTGAGCTTCAGCTACCAGCGTACGTTGGCGGCTGCGACGGCCTCCGAGGTAGCTCTGACGGCCACTGGAACAG
CCAACTTGATCTGGGCTTACGGCACCTCGTGGCCGATTTCGACGCACAGGAGCGGCACCAACGGTGTCGCCACTTTCAACTTTGCAGCTGCGGGCAACTC
GTCGGGCGGTGCCAGCACGACCGTCAGTAGTTCGAGCGCCGACACATCTTTCTGCGCGGACAAGAACTGCCCCGGAATTGTCGGCGGTACCGCCTTCGGT
ATTATGGCTCTGTGCGGACTGCTGCTTACTGCGGGACTCAAGGCCACGCCAGTTGGCaagctgttgttgcaccGCACAGTGGCCCCACCTCCGGTGAAGC
TTACTACGAACTCCCCCGTGGCCAAACCACACACAATGTTCATGCAGACGTTGGCAGACTTTTACTTCGgcgagcttcttgtcgtgcTCATTTTCGTGGG
TGCCGTCATTGTGCTTATTTCTCTCCTCTCGGACGAGAAAAACTACGACATTTCGGGCCAAGTTAGTATTCTGATCCTCATGTTCTTGATCCTCCCGGTC
GCACGTCTGCCTGTGTGGTCGGTGCTCTTTGGCAGCTCGTTTGAGCGCATTGTCAAATTTCACCGCTGGTTGGGAGTCATCATGAACGTGGCGGTCATTG
TCCACGTGATTCAGGCGCGCAAGGTCGTCGATCTCACGCTCAACGACAAGTACGGCAAGGTGACCCCATTGTACGGCTTCATCGCCTTCGTGTGCTTCAT
CGCCATGTGGGTGATGGCTCTGGAGCCTGTGCGCCGCCTGTTTTTCGAGGTGTTCTACTTCACGCACCGTGTGCTCTCTATCGTGGGGTTCGTGTTCACC
ATTCTGCATGCTCCGGACTTCATCGGACCTGCGGTGTGTGTACCGCTTGCCCTGTACGCTCTGGGCTTATTGTACCGTTGGTCCAGCGCATTCACGGGCT
CGTACaaggcgatggcgatggtgaACTCGGCTTCAAGCTCCACGACGCTCGTGCTGGAGGCGACCCCGAAGACGGGCAAGTTGGCGATGCGCGTGAACCC
TGGCTCATATTTCCTCGTGCGTCTTCCTGCCATTTCAGCTACTCAGTGGCACCCGTTCTCTTCTATTGTCACGCCGGACGGCAAGTCGCTGGGTTTCTGT
GTCAAGGCCATGGGCAACGGCTCCTTCACGCGTAAGCTCCTCGAGAAGGCTGGCACGCAGTACGACCTAACAGCCAACTTGTGTGGTCCTTTCGGCAAGA
TGTCGCTTGACGTGGAGCGTTATGACGCGGTCGTGCTGGTCGCCGGTGGTGTGGGTATTACCCCGATGATGAGTCTGATCAACCAGAGCCGCCTGTTCCC
GTCAGCTCTTGCTCAGTCGGACAAGGCCGCCAAGGCATCAGACTGGTATGTTGTGTGGTCGGTCCGCGAGCCGGAAGACATTTTGATGATGGAGCAGTTC
CTACCGACGCAGGCGCAACTCGACTACGCGGCTCGTGCTAGCAACAACCTACAGGACCCTAACACTGCCATCCTCGGAAACAACGGGCCGCAACCGGTGA
ACATTAACTGGTTGTTCCACGTGTCAAATGCACGCAGCGATGGCGTGGTAACCCGTGCCAATGGTGAGACTTTGTCGTACCGCGGTGGTAAGCCGATTCT
CGACGAATTGATCAACACAAGTCGTTTCAATGGCCGTCGCGTGACGGTTGTGGCTTTCGGACCCCCCACTATGACTGTGGAGGCTCAGTCGCTTGCTCGC
AACTGTAACTTCGACTTCCACAAGGAGGTCTTC