Description :
From Genome Similarity Track
Location :
Scaffold_729:11077- 12290
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_729-fgenesh-gene-0.5TPR repeat-containing protein

Sequence
1213 bases(100 bases per row)
GATACTTTCCGTGCATTGCTCAGATTCACATCAGCTCCAGCATCCAGCAGCATCCGCACCAGACTGATTTCTCCATGGTTGATCGCGAGTAATAGAGGCG
TCATTCCCAGTTTATCCATCGTATTCACCTCGGCGCCATTTTCTAGCAGGCAATTAACGATTTCGTTGTGGCCCGAACGACACGCGACATGGAGCGGTGT
CATGCCGTCGCTGACGGCTGCATTCGGATCAGTGCCGCGCGCCAGAATCGATTGCACCGCGTACACTTGGCCAATCTGGCACACCAAATACAAGCCCAAC
TCCCATTGTCGCGCATCATCTAATTCTGCGATGGCCACATGTTCATTTAGGATGTCGCCGAACTGAGCAAGCAAATGGTCACGAAAGTCTACCAGAAAAG
AGCCAAGTGTCTTGACTTTTGCCGAGCGGATCTGCAGTTTTGGCAGTGATGGCTGCGTACGACGTGGAGCTTGAGTTGCACCCAGGATGTACACGGAGCT
GCCTCGATACTTTCTCGAGATGTCATCGCCCTCTGTGTCCGTGGAGGCAACCTCATCATCGGTGATAGCGTGGTCTCGTCCATGAATTGCAAGTTCGTGG
TACTCCTCATGGGCTGCAGTCGTGTCTTCAGGCAATGTGCGGAGACTCGGGATATAGACTGTGGGGATCTGGTACTCAGTCAAGTGCTCCGATGTGTCGT
CGTCGTCGTCGTCGTCATCGTCGCCATCGTACTCCTGCTCGTCGTCTTCATGGCCGTCACATGGTCTAGAAGTCGTGAATTGCTCAGATCCATGAAGGTT
ATTGTGTTCATAATTGTACGACGAAGAAGTCCTGGGCACTGGACGCTGGTCTCGGTTCAACAACATGTCTGCTTTCCACGCTGCGACCAGTAAGGGCGAC
CGGTTGATAGCCATCGAGCGCAGCTCTTCGTTGAAGCCAATGAACGTCGCAAACAGGTTGAGCACACGACAGTGCTCATTCGAGTCCACCGAGTGCAAGA
AACTGCGCGGGAAACCGATGAAGAACTCGCGCACATCGATCACGAACTGCTCGAGCGCGTGGCGTCGTGTCTCAAGGATGGTCGAGGAATTGCGCTTGAG
TACCATCTTTGGCGGGAACGGGTAGCATTTCAGCATCAAGTAGAGACGAGTGAACGGGCAGCACGAATTACTGCATGGGCATGCACCAGGTGCGAGTGTG
ACGGTAGTAGGGA