Description :
From Genome Similarity Track
Location :
Scaffold_212:11075- 16289
Sequence
5214 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTTGGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATG
GAACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGC
AAGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTAGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGC
GGCGTCGATGACGCGCGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACC
CGTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGG
CACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCG
TATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGAGTTATTGGACTATGTCCAAGAGTTAAGAACTCTTATCGCCCGGAATGGCGGCGGACCC
TCCTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAAGAG
GCGGTGAATGTGCATTAAATGCCGAGCACAACTTCAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGA
CCTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCACCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGG
GTATATTGCCCTCTGCGCAAGAAGCGCGTGGCTCCGGCGAGCCAACCCTCCGGGGCATCGCCTGGAAACGGCAATTCCCAGTAGGCGCGGGGCGGCCTAC
TGGGGAAGAACTGCGTTCTGTTGTGCCTCGAGGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAAAAGAGTGTGTGCAAG
CCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCACAGCCATGGAGAGTCTTGATTGACTCGAGAACCTCGGGCAACGACGCCCGTCGCTCCA
CCCTAGAAGGGAGTCAGCTGTATGCTGAAGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAA
GGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGCTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATG
GCATGGCTGGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCA
CCTCTGCTAGGAAGCAGAAGCGCTTATGGCGCGAGAACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGCTAGCAACGAGGTTGC
TGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCCGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGA
GTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGCG
GCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCGAGGACCTCTTGGCTTTCAGCCGTGTGTCTTGCGAGACACTGTATCCTCTTC
GAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGA
CGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGAGGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGATCAGCTGTACACACTCGTGA
ACGGGGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGG
CGAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGTTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGAC
ACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGA
AAGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTCACAAGGCAATGGCCTTTGCC
GAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGT
GTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTC
TGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGC
GGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTT
AGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACT
TGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCAT
TGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTA
GCCTATTACTTGCACAAGTACAGCGCGAACTACGCCGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGC
ACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTC
CGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAAC
TATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATC
ATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAA
GCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGCTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATA
CGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGCGTTTAAAGATTCTGACAAGGAATTGTCTGGGCGCTTAC
GCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCT
AAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCC
AAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGGCAAAGCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGT
CCCCAAGGGATGTTGGCAGTCCATGCGTATGGACTTTGGGTTTGACCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTG
AGTAAGAGGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTG
AGGCAACCGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGCGTGCTCGACACTCGTTTGGACATGTCCACAGCGGACCA
TCCGCAGACCGATGGTCAAACCGAACGCATGAATCGCGTTGTGGAGGATATCCTCCTAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTC
CCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAGCGGCTTGGTTAACCCTCGCGTCCCACCGACGC
CCCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATATCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTC
TTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGACTGAAAGCCAAGATATGCAAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGA
AAGGTTTGAGGTCGGAGACCAAGTTTTATTAAATGCAAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATA
GGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTATAATTTCAACGAAGATGCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGC
CGTATCAGGACCCT