Description :
From Genome Similarity Track
Location :
contig_162:11074- 22426
Transcript NameFunction/comments
g14478.t1hypothetical protein
g14479.t1hypothetical protein
g14480.t1hypothetical protein

Sequence
11352 bases(100 bases per row)
GTGCTGCTTTTTGCCTTCTTCTTCGCTGTCGTCGATGCCACAGGCTTTGCCTTCCTTTTCGCCGCCCTCGATTCCGTCTCCTTCTCAACACTGTCGACAT
CCATCTCCTCCACTTCCTCGTCGTCATCATCATCTACTTCGTCGGGATTAAACTCGCTGTCGTCGTCCTTGGTAGTTCTCGTGACAGCCAGTTTCTTTCC
AGAGCCAGCGGACGTCTTCGCGGCAACAGCTCGGCGCTGCTCGGAGACTAGACGCTTCTGGGCCCTAAGGTAAGAAACGTCCTTACCCGTCGGAGGTCTC
GCCGGAGGTTTCCAGGTCTTGCGGGGGGCAGTGCGCGGCTCTTCAGCCGCTGATGGCGCCTGGTTGTCGTCCCTGAAGTCAACGTCGGTGTCGCGCTCTC
CGGCCAAATAGGCAGCATGTTCCTTCACAAGATGCTGCCGCTCCTCTGGGCTACGACCACCCAGACGTTCCAGAACGCGCTGGTGCTGAGCTCGGGATTC
TCGCCGGGCCTTATTCCTCGCCATGCGTCTCCTGCTTTCTTGCGTTCTTTTTATTTTTCTTCAAATGAACACCAGCCATCTACCGATGCCAGTTTCGTTT
ATGAACGGTTTATGCCTACTCCTGTGCATTTGCGGGAAAGTCTCGGCTTTGTCAGCATTTGATTAAATTTGAGTTCACTATACTTAGCCGTTTTCCGAGC
CAACCCCTATTCAAACATGTTGTACGTACAACATGATTCATGTTGTCAAATACAACGTGTGGGCGTAGGGGGGTTAACCCTTTCATGAGCCACCTACCTT
AACTATACTATACAAAGTTAAGATACTGGTTTGTAGAAGGAGGCAAAATGCCTCCTTTTGAGGTGGTGATGGGCTCTCCAGCTAAGTACGCAGTCAGACA
ACACGACACCTGTAGTTACATTTTGCGGTAGGGCTCTTGTAAAAGGAGGCATTTTGCCTCCTTTTACGAAGACACGGTACTGCGTCGGCATGTACCTGAT
TGGGCAGATTCGACTCCTCTTCAGTGATTGGTCCAAACGATCCAATGAAACACCACAAAAACCACGGCCCCCCAACGTAAATTTCCCATCGCATATGGTA
TCCTTGCATAGACGTGCATCTGCCGGGAGCAATTATGTGGAGCATTTGTCTTTATTAAACTATACCAACCACTCTGAAGGCTGTGCAAACCGCTCATTTC
CTGATTTTTTTCTCCCTGTACGAAATGGCGCGAAAGCACGCGCGCGGAGAAGAGATGCCAGCCGAGCCAAAGCGGCGGCGACCGCGGTGTGATGCAGCGT
CCCAGGACAATGACACGGCACGTTTAACGAGGGTGCTCGACTTCAACGGCGTGTGGAAGGAGCTGAAGGCTGCTGGATGGACGCATAAACTGCCACGCGG
TCTTGACAACCGGTATCGGTACGTGCTACCTGGTCGCTCTGCCAATGGAAAGGATGGCGAGGACTTCCTGCTAGGCGAGGAGACTGTACTTCGGTACTTC
ATTCAACACAGTGCTTCAAGTGGCGGTGATGGCGGCGCGGCGACGGCCACGGCGGGACGGCAGCAAGCAGTCGGTGGCGCGCGTGGACTTGGCGATGGTG
ACGGCGGATGCGGTGGGACCGGCGACGATGGCGGTGATCGTGGACCTGGTGACAATGGTGTCTGCCGCATGGCAGCAAGCCATTATTCACGTGAGCCTGG
CAACGATGGTGTTGTCGCGGCATCAACCGGATGGCAGCAAGCAGTTGTTGACGCGCAAGGGCTTTGCGACGATGGTGGCGGCGTTGTGGCAGCGGGACCT
GTCGGTAGTGCCCGCGGTAGTGTTCGAGTTCGTGGGTGTGGGCGTCGGCGCGGTAGTGGTCTTGGCCGCGGACGCGGAAGCGGTCGCGGAGATCGAATTG
TCAGGAGCGTGATGGAAGAGGCGGCTACCGCAGCTACCGGGGCGGAGACTTCAAGACGGCAAGCGAGCTTGTGATTGAACCCAACCTAGAAACCCCAACG
AGTGTCCCCACGCGCAGTACGCCGCAGAGACGTACTCCTCCTGCCCCTTTGATGGAGCATCTATTCCTAAAGAAGCTGGTGGCATTTTCACCGTCAAAGG
AATTGTGGATGAAGGAAAATATGTATAGATGCGTGGGCACAGCCTTTATTGTCGGCCGTGTGTGTCGTCAGGTCAAAAAGACGAAGAAGGGAGGGGTACT
ACAAGTAATTTGGCTAGATACGGAGTTCCAGAATGCAGTTGAAACTCTGAGTGTGGCAGTAATTCAGCGCGGGATCGAGAACTACCAGGCTCTCGCGCGC
TCACCCAACAAGCCGGCGTGGCGTGAATTGACTGATACAGTGGTGGAAGGGGAGCTGCAGATGGAGGAACCGCTCGATGAACTTGAAGTCGCGTCAGACG
ACGACGGTATGGAAATGTACGATCCAGAGCGATTTTTGCCCGTGAGCCTTGCGGAGGTGGAAGCGGTGAAAGTATGCGGTTTCAGCCAGATGTGGATATG
GATGGCCCCACGGATCTGTATGAACACACGGACGAGAGCACTAGTACACGCTTACTACCCGAGTACAGTCACCTGTTTGCACACTCAGCCTCTTCGAGCT
TCTTCGCTTACATTCCAATTTACTTCTGGAAACAAGTGGTTCTGAGACGAATCGATATGCAGCCCTCAAGAATGTTCGATCACCACGCCGTTTACAATGG
AAGAGCTGATGATCTTCCTCGGCATCATGCTTTATCTGACCCTCACTGACAAGGGGGAGTACTCTAACTACTGGGGGCCACAGACTGAAGATGCGGTTTT
TGGTGGTGCATCTACCAGCTTGGACAATGTGATGAGTCTAAATAGATTCAAGTTGCTTCGCCGCTGTTTGAGCTTTCGCGCTGATCCGGGATCGGCTGTG
GAACGAGACCCAGCAGCCCGAATTAGGCCCCTATTGAATTTGCTCAAATGCACTGGTGGTCGCTATGTTGAGCCTGGCCGTGACTTGGCTCTTGACGAAG
CGAGTATCGCATGCCGGTCCCTCCATGGACGACATCTTATCGTGTTCAATCCCCAAAAACCTGGCGGCAAGTATCATTTTCGTGTGTACGTGCTGTGCTG
CTCGACCACGTGGATCGCTTTGAACTATCGCCCCCACTGCACTAATAGTGATATCGCGGACCGCCTGCAAAACGTGGTGATCCCAGAAGAGGTGCAGCAG
CTTCGTGAGGAGCTCGAGGATGTCAAACAAGTGCGTAAGCATGTTCTAGAGGTCGTGAGGCCCTACTTTTACTCTCGACGAATCATCAATATGGACAACT
ATTACACAAGCGTCCAGTTGCTGTTGGATTTGCGTTTGAAGGGGTTGTATGGGCGGGGAACTGTTCGGGGAAGGAGTAAGCACTATCCGAAGCACACTAT
TCTCCAGAAGGAGCACTCAACAAGGGGTGACTATCAGCAGTCTGTCTCCCTGGAGCACAACTTGCTCGGTGCGTCGTGGTGCGATGGCAATACCGTGATG
ATGGTTACCAATGCTGATGCATCTACTGCCGCGACAGTCACGCGGCGGGTTGGTAAAAATACTCATGAGTTTCCTGCTCCGAGCTGTATCCTGCAATACA
ATCGACGCATGCAAGGTGTTGATCGTTTGGATCAGATACGAGCTAGATTTTCACTAGCTGATGGTCATTCGTTCAAAAAATGGCATAAAAAATTGGCTTT
GGCAATAGTGGATATTGCACGGTCCAACGCGTACCTGACTCGACGGATGGCAATCGACACTTCCAGAGATCGAGATCCCCACAGGACGTTTGTCACTGAA
TTAGTATCTGAGCTAATTTCTGGCAGGTGGCAAGAAGCCCCGAGCGATAGTCAAATGGCGTTTGGAAGCGGTGTTGCTGATGAAACCGCAGCAGTGGATG
CAACTGGTATAACTCCTAAAGTGTACACTTCGCCAAACCCGCACAGCGCCCTGAAGCGATGTCAGTCTATGCCTTCGAAACAAATGTTCAAGGACAGTGG
GCGGAAACGTCGGCAGTGCATTGTGTGTCGCTACGAGGGCAGATATCCTACAGAGGTGACGGATTATTGCCTCACGCACACTGTTTGTCTTTGTAGCACT
GTGCATGGATACATCGAGAGTCCGTACACGTGCCCACAGAGCACTTGAACTTGTTGGGATAAGTTTCACAGATTCTATCTCCCAAATGGCCTCTTCAGTG
ACAATGGAAATGTCAACAGGTCATCGCATCTGGCTAAGTTGAAGGCAAGTAGCGCCGCGAGACCCGTCGATAAAGTTCTCCCTATCCCCCGAAAGCGATA
GTGTCGTGCTCTCTTATGAGACCCAGAGCGACAGTTCTGTACTCTCTGTCGACGAAACCGACCTACTTCTCAGTAGTGATTGTGCAGAGTTGCTCAGCGA
AGATTCAGCGAGTCAAGACAGCAGAGATGCGCGACAGATATTCCAATGATTCGCATTCTGTAGGCAAAGAAGAGGGTATTTATCTTGATTAAAGTATGCT
AATGCCTTCAGAGCAACATGACCGAATATATATCGAATAAACTATGGTCAATGTCTTTAGCATTATCAACAAGTGTTTCTCGTCCCAAATAACACAGTGG
CAGCGTTGCACCCACGGCCATCGCCGCGGGATCTGTTCGGCCATCATCGCCAGCGTCAGCTCCAACTGCAGCTCAGTGCCCGCGACGTTCCTGTGGTAGG
CCAACTGCGCCGTTCTGGGCATCACCACGGCCTTGACAGCCGCCGCCAGCCGCGTTGTGTCCGTCGTTCCCTCCTTCACCAAGTCCATTCGCGCTGAGAC
TGCGGCCGCCCAGTCCATCCCCAAGCTGCAGCTGTCGTGCGCCAAGTCCTTTCGCGTCGCGCCCGCGCTGTGGACGCCGTAAACATGTGCGCAAAGTCCA
GCACACGCTGTTGCCGCCCGGCACCAAGTTCAGCGTCCCGTGGCCGACGTTCCTGATATGTTGCCGCCGTGCACGCAGCTCGGAGTGCCGTGGCCACCAT
GCCCGTGTTCGCTTAGTCCTGTTGAGCTGCGCTCGCAGTCGCCAAGTCCCGTCGCCGCCCGCTGTCGTCTAATCCAGCCGTGCCCGTGCGCGCCATATCC
AAGCTGTCGTTCACAAAGTCCAGCGCGCCGTAGTTGCCGTGCCCGCTTGCACCAAGTCCAGTTGCGCCTTGACCGCGATGTTGCTGCCGTGTACGATGTC
CAGCGCGCCATGGCCGCTGTGAATGCGTGCGTCAAGTCCAGTCGCGCAAGTCCGTTGCAGGCTTTTAGCATTGTTTGTATATGTATATTGGAAGTGGTAG
TGCCTTCCAACTGCCGCGGCCGTAAGTAGTTGCCGTCAATTTCCATCTCGCGCAAAAGCTGTTGCGGCATGATTCACGGTGGCGGGGGCAATACTTAGAC
GTGGATACTATCAGTCGGGCTCTTGGCATGCGAGTAAGCTCTTGTTGCACCACGAGCTTGGCGGCTTCATCAAACAGGAAATCATTAAGGAAAATGATGG
TTGCATCGTGAAATGGTGCGGACGACCACAGCGGCGTATCGCGTACGTCCCCAGACTTCAGACTTACCTTGTGCAGAAGCACTAGTCGCGACGCACATGA
TCGCACGCACTCATACCCCCTGCGAGCAATATCCACCCTTTTCTCGATCCCCAAACACTGTCTAGCTTTTGTCTGCAACGCGAACTGTGCAGCAACATTT
CCCAAACCAGCGCCTTTGTCTAGAAAGACATCATCTGGCTTCACCGCTCCAATACTTCGAATGATACCCGACACCGCAGCAAGAATCATCTCCCCGGCAT
TTCCGTCAGTTTTACCTGCCTCCTGGCGCACATCAGCAGCCGAAACAGCTCCAAAAATCTCACGGATGGCTCTTTCAGCCTGGCTTGGGGACAGGAGGCA
AAACTTGTTCACATATTGAGGCGTTGGCGAACATGTGGAAAAAAAACAGGTAGGGAAACGCCCGAGGTCGTTACTGTAGGTACGCTTTAGAGCGCGCAAT
CTCATCTTGAGTTGTGCTGCCGGACGCTTCCTGCGCATCTTGAGCTCGATGTCCTGCCAGACAACGCGCTTGCCGTGGGACTCATACTCGAGGGCACGAA
CAACGAGCTTCTTGTCTTCTGCGTCGGAAAAACTTGTGCGCATCTGAAACTGACGATAAATGAAAGAGTGAAGGCGAGCATCTCACCTCAGTATTGTATG
AGATAGGTTTGGACGCCCGAACTGGTGGCGCAGCATCACGCGGGTCCAGGATAGAATTTGGGATGGGTCCACCTCGTTTCCACCACCTGTACCCACCATT
TCCTCATTGCGTTTCATGTGAATGACCGCAAAACCACAAAAATCACGGGATATGGGGTGAAAACAGGGCGCTTTCGTGCAAAATTAGCATTTAAATTTTG
ATAGTCGGCCTCAAATCCTCGAGTGGGAACACCTAACCCACCCGCATCTAAAGATCTGATTGGCTTACACAAAACACGGTCTACTGAAACCCTGGTAAAA
GCTAAAAGGAAGCAAAATGCTTCCTTTTAGGGGGTCCATTTTCACCTACTTTTGTGAAAGTGCTTAAAGGTAGCAAAATGCCTCCTTTTACCACGAAAGG
GTTAAGAAATTGGTAGCAAACGCGACAACTTAGAAAGGTTGCGGACTACCCAAGTCATCAGCAGGTATCTCTTTGAACGAAAATGTATGTCATCTGATGC
ATCGTTCCATCGAGGAAATGCATTTTAGAAAACTATCTCGTTCCGCAGTAAGTGAAAAATGGTTTGGCGCCTTGGGTGCTGCTTCTATTGTGCGCGTTTC
AATCAAGCCGAGTATTTCATCGATGGGTGATACAATATACCGCTAAATAATAGTACCTCCAGCCATCAAAACAGGTGGAGAGACTTCGGTACAAATAGGT
CGTGAGGTCAACAAAGATAGCATCCAGTGCACAGACATCATTGTTCAGTGTCTCAGCAGGCGATCCCCAGTTGCCGACTCAACTACAGTGCCAACTACAT
GTAGAAGTACTGCACATCAGACCAAGACCTCGTGAGCTATTCAGCAATGTCCGCCCAAGAGAAGAGAGGCTCGACTACATCTTGCAACATCATCTACTCA
CTAGTACCAGCCCAGCCGCTTCCAGTCGTTGACCTATCCAAGACGTTTCGAGGCCGGCTTATTCCTGGCAGCGTTCACACATACATCCGTCGCCGATACT
ACCAGTACTACCGAGAAATCTTGTTTTGCGCAGCAGTATCCTACTGCATCAACGCCATTGTGCCCATGGTCAAGGCTCCAGTGGGCTGCGTGATGTCGAT
ATTGGCCGTTCTCTTATGGCTCCCTATGGGGTTGGGAAGTGTGACGACACTGAGATACGATATCGTGCGCTTGGTGTGTCGAACGTTCGACTTCTGGTTC
TTCTCCGTTGTCACAAGCGTGATTGTAGTTACGATGTCGATGTACTTTGGAGATTTGCGCTCGGTCCGGACGGTGATCGACTGGATAGGATATCATCACG
TCATTTGTGTTGATGCTCATGTTCTGGGCCTCCGCAGTCTCACTTGCTTTCTGATCGCGGCGATTTTTTCGGTGTTCGTTGCACTTGCTTGGATAATGCT
TGGGCACGTGGATAGTGGCTCAATCTTTTCAATTCTCAAATATCAAACCAGACATGGCAATTTTGAGCTCTCGGGGCTGGATGTGATCGGAAACGGACTG
GTATCACTTGGATTTCTGCTTGCAAAAATTGTGCTTCGGAGACGCAAAGTTTTGCGTTCTCATCCCAAAAGACCAGCTATCGTTGAATGTGTCATTTATC
GCGCCATACTAAAGCTGCAACCAGTGCAAGCACCAGCAGAATCGTCCGCGTGGGAAACGAATGATTCCATGTTCAAAGCAAAGATGTCATCCTTGAGAGA
CACTGATATCGTGCAACATTTAATGTTTGTCAACTTTTCTCAGACCTTCGCCGCGAGTAACACGCTGCTTCCTTGGCTAACGGCAAACAAACGTCGCTTT
CCGCTGTGGTCAATGGTTGTGTTGTATTCAGTTGGAGCAGCTGGACTGATACTTTCTCACGTCGCCCTTGCACACGAGTTTAATGAATCACATGATGATC
CTACAGCACACGAAGATTTTATATTGATGGTATCATCAAGCGCACTGCTGTGCACAGGCGTGTTCACATCTCTATTTGCTGGATTTTACCAGCCCCAACT
ACTCAGTTGCTCTTTACTTCGTTTGACTTCGTGTTTTACTCCTTTCAAGTCACGTCTGCAAGTATCTCTGTGAGCGTCTTGTACAGCTGGGACGTCGCGC
ACAGCTTGATGGTGATTTCGTGGTGGCTTTGGGCACACTGGGTATTCACCTTAGACGCGTTAACTCCAGTCATGCGGGAAATGCTTCGATTTCGTAGTTG
GTTTGCCGCAACCATATTATGCTTATTGCTCGCTGACCACATCGCAATCATATGCCGGATCTTCTTCGCAGGAGATTTACGACTCCAAGACTCGGTCATC
TTTGAGGGCACTATTTGGGGTCAGCAACTAAGCTTTCGTGTGATACCTTTTTACGTCAGTCGATCGTTCACATTGATGTTGTGGTTCTCTCGCTTAGTAT
ACCGGCTTGGCTCAGCATCAAACGACGATGTCACTATTCTTCGTGGAACTGTCTGCTACGACAACGTTTTCGCGAAGGGAAGACGAAAATTTTCGCAGAT
TGCTCATATTGTCGAAGCCAAGACATCAGCAGCAGCTTTCTCTCGACGAGCTAGAGTATCGCCTGCTATGTCGTTCCACCAAGATCCAAGCCTAATGTGA
CACCCAACATATTTCTGCATGTAGGATGTCCAGTTAATCACTTCGATCTGTCATCAAATTGCCAATACGGCGATCCGGATACTACAAAGCGACTGCATAA
CCAGGTGACACCTTATCATGCACGATAGTCCGCAAAATCTCAGATGTGTCCGAGTTGATACCACCACTTGATCAATCCACCAAGGTCGGTTTCAACATAA
CGGTGCATGTGAGGGGTTCAAAAGTATCAGGTTGCTCATCACTCTCCCTCGACCATTCTCTCTGCCCTCATAATATCCGCTAGCACTGTCAAATCGGCAA
ACCCATCAACGAAGTGCACGTGAACAGGAATATTTAGGTTGAGCCTTGGTTTGTTGCCCTGCAAGAGAGTTCTCATTGCTGTTATTTGTGCGAAATAGTG
CACGCATGCTCTACTGTGTTTCTCTTGGTGGTGCAAACAAACAAAAAATTGGAGGATATCTTCAGTTTACCGTCGCGTGCGGCACTCTTCTTCGGCACAC
CACTGCTCGTCCTTGATTAACATATTGAGGTGCCTGTACCATCCACGCCTCGCAGCATTCCGATCCAGTGTCCCTCGTACATTTCATCCCCTTCGTGACC
CAATGGCACCGCACAATGCTTCTCGAATAAGTATCTCCATCCTTTGTAATCCATGTCTGCGACCGCAGTCAGTAGAGCCAAGTCCTCGCGAGCAAGTTCG
AATGTATCTGGCCCATCATAAAACTCGAAGCGTTCTTCGACAGTTGCCCGGACTGGCACAAGTGCTTGGAGGTAACGTCTCGGGTAATCACACATCGGGC
GGGTTTGTGTTTGAGTGCGGTACACCACGGCACCATGAAGCCCCACCTCTAATCTAGATCAGTATCAAGAGCAGCACTACTGCGTGTCATCGTTGGGTTA
TGCAGGGCGCGATAGTTGACTTGAAGCAAATTCTCAGCAGCGAGGTCGGCGGTTTGGTTACATTTTTATTGGAGCAACCGTTCTGGTAGCGAGGAAGCCC
GTGGTGTTCATGCCCTTCTCCATGTATTTAAGTACTTCTGTCGAATTGCGGGTTTGTGCCCGCGTTTGATTATGGCGTCAAAAGCAGTGCTATAACGATG
CTTGTTCCGAGCAAAGGCGATAGCGCTCAGGAGGGCCCCTCCTGAGCCCTCTGGACAATAGCACAAAGGCGTGATAAACCACGAGAGCGAGTTAATCATG
AGACCGAATCACACCCAGTGGCAAAACAGGAATCGTGGTCGAGGTTATCAACGCTAACCGCTCTGAATAATCAATAGCCAGTCGCACCGGATACTCGAAA
TGAATTTGCTGACACTAGTTTAACGAATAAATCATGGCCTTGTACGCCGCCGTTTACTCTTCTGACTGTCCCAGTTCTTCCATTCTGATGCGTGCGTACC
CATTTCCTTAACCAATTGCTTCCGAATTCGGAAAGCCCGTTTAGATTCATCGATCACGACTTCGATGGAGCGAGCGCGCAACTTGGCATTCTCAGTGTGA
ATACTCTGGTACACTTCGTGAGGCACCGATACTTTAGCTTGCCGCAACAGCGATACAAGGTCCCAAAAAACTGATTGGTCATCCTTATTCACAAGCGTCA
AAACATTTCCGGTCGAATCATCTCCACGCCCGATACGCCCAACGAGGTGAACGTAGTCTGACACTTTCTTGGGAAAATCATAGATCACAACATTCTGAAC
GTGCAGCAGATCCATTCCACGGCTCAGCACGTTTGTAGACACGAGGACAGGGGTCTCTAGATTAATAAAGGCCTCCAGCAGATGAAGTCTTTCGCTTTGA
GTTTTATCTGCATGAATCGCTGCTGCACCAATTTGACAGCGTTTTTCAATGGCTTCAGCCAGCATGCTCGCGCCAAGTTTCGATCCGACAAAGACAATCT
ACAACGCCAGCAACACAAAAAGTATCAGCCACCCGTCAATGATGTCAGCTAGCTTGAAATTCCATAAGAGTCAATGCAATCACCTCACCCACCGTTGACT
CTTCGTATTTCCCTTTCAAGAACTCAAACAACTCACTCTTTTTCACCTTGTCGTCCGACCATCGAACCTGTTGTTTAACACGAGGGTTGAGTGCGAAACT
CGGTGTCCCAGTTGTCTTCGAATCACTGCGACGAACGTCGACGCGAATATAATTTTGCTGGCTTTGAACTTGCAAGATTTGCCGCACCATTTCTTCTACC
TCGCCAGCGACGGTGGCGCTGAAAAACAGCATCTGGACGCTCTTTTTCCCAGCTAATGCTACCAATAAAGCCACGATTTGAGAAATCTGTGGACGAAAGC
CAGCGTCCAGCATAATGTCCACTTCATCAACAATACACATGCGAATAGCTGCCAGGATAGCATCACCGCCACTGTAGTTCATGAAAATATCGAGGAAGCG
CCCCGGTGTCGCCACAATAAGCTGAACTCCACCTTGTAGTCGATAGCGCTGGGTGGGGACAGGGAATCCCCCACCAATAGCGCCGTCTTCATGTCAGCTA
TGCCTCTCACCAGCAGCTTTGCCACCGTCTCAATCTGAATTGCCAGTTCTCG